EMAIL THIS PAGE TO A FRIEND

ODF2

outer dense fiber of sperm tails 2

110 Gene Product Result for
Synonyms: CT134 ODF2/1 ODF2/2 ODF84
Gene ID:
Human(4957) Summary: The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. This gene encodes one of the major outer dense fiber proteins. Alternative splicing results in multiple transcript variants. The longer transcripts, also known as 'Cenexins', encode proteins with a C-terminal extension that are differentially targeted to somatic centrioles and thought to be crucial for the formation of microtubule organizing centers. [provided by RefSeq, Oct 2010]
Mouse(18286) outer dense fiber of sperm tails 2
Rat(29479) outer dense fiber of sperm tails 2
naked mole-rat(101722883) outer dense fiber of sperm tails 2
domestic guinea pig(100734071) outer dense fiber of sperm tails 2
Zebrafish(792921) outer dense fiber of sperm tails 2
chicken(417213) outer dense fiber of sperm tails 2
cow(539043) outer dense fiber of sperm tails 2
Horse(100070205) outer dense fiber of sperm tails 2
domestic cat(101100514) outer dense fiber of sperm tails 2
dog(491315) outer dense fiber of sperm tails 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002540 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001113213 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001113213 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001113213 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002540 Rosetta Predictions human pricing
NM_153437 Rosetta Predictions human pricing
NM_017213 Rosetta Predictions rat pricing
NM_001113213 Rosetta Predictions mouse pricing
NM_001113214 Rosetta Predictions mouse pricing
NM_013615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334028 predicted 1694
2 SASI_Hs01_00063968 predicted 1196
3 SASI_Hs01_00063969 predicted 1228
4 SASI_Hs01_00063971 predicted 1789
5 SASI_Hs01_00063972 predicted 2001
6 SASI_Hs01_00063973 predicted 1546
7 SASI_Hs01_00063974 predicted 1913
8 SASI_Hs01_00063975 predicted 1701
9 SASI_Hs01_00063976 predicted 1429
10 SASI_Hs01_00063977 predicted 1986
11 SASI_Hs01_00063970 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367278 predicted 1392
2 SASI_Hs01_00245822 predicted 891
3 SASI_Hs01_00245823 predicted 919
4 SASI_Hs01_00245825 predicted 1488
5 SASI_Hs01_00245826 predicted 1700
6 SASI_Hs01_00245827 predicted 1241
7 SASI_Hs01_00245828 predicted 1612
8 SASI_Hs01_00245829 predicted 1395
9 SASI_Hs01_00245830 predicted 1128
10 SASI_Hs01_00245831 predicted 1673
11 SASI_Hs01_00245824 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045667 predicted 534
2 SASI_Rn01_00045668 predicted 387
3 SASI_Rn01_00045670 predicted 1412
4 SASI_Rn01_00045671 predicted 610
5 SASI_Rn01_00045672 predicted 1133
6 SASI_Rn01_00045673 predicted 702
7 SASI_Rn01_00045674 predicted 899
8 SASI_Rn01_00045675 predicted 637
9 SASI_Rn01_00045676 predicted 1588
10 SASI_Rn02_00261576 predicted 381
11 SASI_Rn01_00045669 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307273 predicted 853
2 SASI_Mm02_00307274 predicted 1466
3 SASI_Mm02_00307275 predicted 1040
4 SASI_Mm02_00307276 predicted 1048
5 SASI_Mm02_00307277 predicted 1363
6 SASI_Mm02_00307278 predicted 1663
7 SASI_Mm02_00307279 predicted 1644
8 SASI_Mm02_00307280 predicted 1889
9 SASI_Mm02_00307281 predicted 888
10 SASI_Mm02_00307282 predicted 1708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307283 predicted 860
2 SASI_Mm02_00307284 predicted 1463
3 SASI_Mm02_00307285 predicted 1036
4 SASI_Mm02_00307286 predicted 1047
5 SASI_Mm02_00307287 predicted 1362
6 SASI_Mm02_00307288 predicted 1662
7 SASI_Mm02_00307289 predicted 1643
8 SASI_Mm02_00307290 predicted 1897
9 SASI_Mm02_00307291 predicted 891
10 SASI_Mm02_00307292 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322374 predicted 830
2 SASI_Mm01_00065508 predicted 1442
3 SASI_Mm01_00065509 predicted 1013
4 SASI_Mm01_00065512 predicted 1024
5 SASI_Mm01_00065513 predicted 1337
6 SASI_Mm02_00322375 predicted 1634
7 SASI_Mm02_00322376 predicted 1620
8 SASI_Mm02_00322377 predicted 1864
9 SASI_Mm02_00322378 predicted 866
10 SASI_Mm02_00322379 predicted 1682
11 SASI_Mm01_00065504 predicted 532
12 SASI_Mm01_00065505 predicted 373
13 SASI_Mm01_00065506 predicted 440
14 SASI_Mm01_00065507 predicted 626
15 SASI_Mm01_00065510 predicted 691
16 SASI_Mm01_00065511 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002540
VALIDATED
ODF2 MISSION shRNA Bacterial Glycerol Stock
outer dense fiber of sperm tails 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-1096s1c1
Sequence:CCGGCTTCAGAAGAAACACCTACAACTCGAGTTGTAGGTGTTTCTTCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-2145s1c1
Sequence:CCGGCAACTATAAGAGTCAGGTGATCTCGAGATCACCTGACTCTTATAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-1363s1c1
Sequence:CCGGGAAAGACTAATGGAGCAACAACTCGAGTTGTTGCTCCATTAGTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002540.3-3517s1c1
Sequence:CCGGCAAGTTTCTTTGAGGCCACTTCTCGAGAAGTGGCCTCAAAGAAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002540.3-3283s1c1
Sequence:CCGGCCATGACTTTGCTCCTTCCTTCTCGAGAAGGAAGGAGCAAAGTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-1701s1c1
Sequence:CCGGCCGAGACAAAGAGAGCTTGAACTCGAGTTCAAGCTCTCTTTGTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002540.3-2004s1c1
Sequence:CCGGGACTGCTGAGTATTCCGCATTCTCGAGAATGCGGAATACTCAGCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002540.3-906s1c1
Sequence:CCGGGAATGCGGTTGGTTGTCTGAACTCGAGTTCAGACAACCAACCGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-3570s1c1
Sequence:CCGGGCTTGTGTCCATTTGGCCTTTCTCGAGAAAGGCCAAATGGACACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002540.3-3283s21c1
Sequence:CCGGCCATGACTTTGCTCCTTCCTTCTCGAGAAGGAAGGAGCAAAGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002540.3-2004s21c1
Sequence:CCGGGACTGCTGAGTATTCCGCATTCTCGAGAATGCGGAATACTCAGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002540.3-1096s21c1
Sequence:CCGGCTTCAGAAGAAACACCTACAACTCGAGTTGTAGGTGTTTCTTCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002540.3-1701s21c1
Sequence:CCGGCCGAGACAAAGAGAGCTTGAACTCGAGTTCAAGCTCTCTTTGTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002540
VALIDATED
ODF2 MISSION shRNA shRNA Plasmid DNA
outer dense fiber of sperm tails 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-1096s1c1
Sequence:CCGGCTTCAGAAGAAACACCTACAACTCGAGTTGTAGGTGTTTCTTCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-2145s1c1
Sequence:CCGGCAACTATAAGAGTCAGGTGATCTCGAGATCACCTGACTCTTATAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-1363s1c1
Sequence:CCGGGAAAGACTAATGGAGCAACAACTCGAGTTGTTGCTCCATTAGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002540.3-3517s1c1
Sequence:CCGGCAAGTTTCTTTGAGGCCACTTCTCGAGAAGTGGCCTCAAAGAAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002540.3-3283s1c1
Sequence:CCGGCCATGACTTTGCTCCTTCCTTCTCGAGAAGGAAGGAGCAAAGTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-1701s1c1
Sequence:CCGGCCGAGACAAAGAGAGCTTGAACTCGAGTTCAAGCTCTCTTTGTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002540.3-2004s1c1
Sequence:CCGGGACTGCTGAGTATTCCGCATTCTCGAGAATGCGGAATACTCAGCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002540.3-906s1c1
Sequence:CCGGGAATGCGGTTGGTTGTCTGAACTCGAGTTCAGACAACCAACCGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-3570s1c1
Sequence:CCGGGCTTGTGTCCATTTGGCCTTTCTCGAGAAAGGCCAAATGGACACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002540.3-3283s21c1
Sequence:CCGGCCATGACTTTGCTCCTTCCTTCTCGAGAAGGAAGGAGCAAAGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002540.3-2004s21c1
Sequence:CCGGGACTGCTGAGTATTCCGCATTCTCGAGAATGCGGAATACTCAGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002540.3-1096s21c1
Sequence:CCGGCTTCAGAAGAAACACCTACAACTCGAGTTGTAGGTGTTTCTTCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002540.3-1701s21c1
Sequence:CCGGCCGAGACAAAGAGAGCTTGAACTCGAGTTCAAGCTCTCTTTGTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002540
VALIDATED
ODF2 MISSION shRNA Lentiviral Transduction Particles
outer dense fiber of sperm tails 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-1096s1c1
Sequence:CCGGCTTCAGAAGAAACACCTACAACTCGAGTTGTAGGTGTTTCTTCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-2145s1c1
Sequence:CCGGCAACTATAAGAGTCAGGTGATCTCGAGATCACCTGACTCTTATAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-1363s1c1
Sequence:CCGGGAAAGACTAATGGAGCAACAACTCGAGTTGTTGCTCCATTAGTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142762    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002540.3-3517s1c1
Sequence:CCGGCAAGTTTCTTTGAGGCCACTTCTCGAGAAGTGGCCTCAAAGAAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002540.3-3283s1c1
Sequence:CCGGCCATGACTTTGCTCCTTCCTTCTCGAGAAGGAAGGAGCAAAGTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-1701s1c1
Sequence:CCGGCCGAGACAAAGAGAGCTTGAACTCGAGTTCAAGCTCTCTTTGTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002540.3-2004s1c1
Sequence:CCGGGACTGCTGAGTATTCCGCATTCTCGAGAATGCGGAATACTCAGCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_002540.3-906s1c1
Sequence:CCGGGAATGCGGTTGGTTGTCTGAACTCGAGTTCAGACAACCAACCGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002540.3-3570s1c1
Sequence:CCGGGCTTGTGTCCATTTGGCCTTTCTCGAGAAAGGCCAAATGGACACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002540.3-3283s21c1
Sequence:CCGGCCATGACTTTGCTCCTTCCTTCTCGAGAAGGAAGGAGCAAAGTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002540.3-2004s21c1
Sequence:CCGGGACTGCTGAGTATTCCGCATTCTCGAGAATGCGGAATACTCAGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002540.3-1096s21c1
Sequence:CCGGCTTCAGAAGAAACACCTACAACTCGAGTTGTAGGTGTTTCTTCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002540.3-1701s21c1
Sequence:CCGGCCGAGACAAAGAGAGCTTGAACTCGAGTTCAAGCTCTCTTTGTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001113213
VALIDATED
ODF2 MISSION shRNA Bacterial Glycerol Stock
outer dense fiber of sperm tails 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-392s21c1
Sequence:CCGGCTCCTGTCCACGTCCACATAACTCGAGTTATGTGGACGTGGACAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-452s21c1
Sequence:CCGGCTCATAAGCGCGGAATGAAAGCTCGAGCTTTCATTCCGCGCTTATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-438s21c1
Sequence:CCGGCAGCAGCCAGAAATCTCATAACTCGAGTTATGAGATTTCTGGCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113213.1-365s21c1
Sequence:CCGGCCTTACATGTTCACGTGGATGCTCGAGCATCCACGTGAACATGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-567s21c1
Sequence:CCGGGTGGGAGAATCCACCTCATTGCTCGAGCAATGAGGTGGATTCTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001113213
VALIDATED
ODF2 MISSION shRNA shRNA Plasmid DNA
outer dense fiber of sperm tails 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-392s21c1
Sequence:CCGGCTCCTGTCCACGTCCACATAACTCGAGTTATGTGGACGTGGACAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-452s21c1
Sequence:CCGGCTCATAAGCGCGGAATGAAAGCTCGAGCTTTCATTCCGCGCTTATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-438s21c1
Sequence:CCGGCAGCAGCCAGAAATCTCATAACTCGAGTTATGAGATTTCTGGCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113213.1-365s21c1
Sequence:CCGGCCTTACATGTTCACGTGGATGCTCGAGCATCCACGTGAACATGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-567s21c1
Sequence:CCGGGTGGGAGAATCCACCTCATTGCTCGAGCAATGAGGTGGATTCTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001113213
VALIDATED
ODF2 MISSION shRNA Lentiviral Transduction Particles
outer dense fiber of sperm tails 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-392s21c1
Sequence:CCGGCTCCTGTCCACGTCCACATAACTCGAGTTATGTGGACGTGGACAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-452s21c1
Sequence:CCGGCTCATAAGCGCGGAATGAAAGCTCGAGCTTTCATTCCGCGCTTATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-438s21c1
Sequence:CCGGCAGCAGCCAGAAATCTCATAACTCGAGTTATGAGATTTCTGGCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113213.1-365s21c1
Sequence:CCGGCCTTACATGTTCACGTGGATGCTCGAGCATCCACGTGAACATGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113213.1-567s21c1
Sequence:CCGGGTGGGAGAATCCACCTCATTGCTCGAGCAATGAGGTGGATTCTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)