EMAIL THIS PAGE TO A FRIEND

ODF2L

outer dense fiber of sperm tails 2-like

95 Gene Product Result for
Synonyms: RP5-977L11.1 dJ977L11.1
Gene ID:
Mouse(52184) outer dense fiber of sperm tails 2-like
Rat(685425) outer dense fiber of sperm tails 2-like
chicken(424524) outer dense fiber of sperm tails 2-like
dog(490179) outer dense fiber of sperm tails 2-like
cow(533508) outer dense fiber of sperm tails 2-like
Horse(100063710) outer dense fiber of sperm tails 2-like
domestic cat(101100578) outer dense fiber of sperm tails 2-like
domestic guinea pig(100728380) outer dense fiber of sperm tails 2-like
naked mole-rat(101709337) outer dense fiber of sperm tails 2-like
sheep(101114828) outer dense fiber of sperm tails 2-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020729 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007022 Rosetta Predictions human pricing
NM_020729 Rosetta Predictions human pricing
NM_001134708 Rosetta Predictions rat pricing
NM_025714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220772 predicted 1788
2 SASI_Hs01_00220773 predicted 995
3 SASI_Hs01_00220774 predicted 1103
4 SASI_Hs01_00220775 predicted 1734
5 SASI_Hs01_00220776 predicted 1099
6 SASI_Hs01_00220777 predicted 878
7 SASI_Hs01_00220779 predicted 890
8 SASI_Hs01_00220780 predicted 1830
9 SASI_Hs02_00305173 predicted 1798
10 SASI_Hs02_00305174 predicted 805
11 SASI_Hs01_00220778 predicted 815
12 SASI_Hs01_00220781 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015887 predicted 1924
2 SASI_Hs01_00015888 predicted 1125
3 SASI_Hs01_00015889 predicted 1232
4 SASI_Hs01_00015890 predicted 1869
5 SASI_Hs01_00015891 predicted 1225
6 SASI_Hs01_00015892 predicted 1011
7 SASI_Hs01_00015894 predicted 1019
8 SASI_Hs01_00015895 predicted 1967
9 SASI_Hs02_00353798 predicted 1923
10 SASI_Hs02_00353799 predicted 936
11 SASI_Hs01_00015893 predicted 948
12 SASI_Hs01_00015896 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258084 predicted 537
2 SASI_Rn02_00258085 predicted 1872
3 SASI_Rn02_00258086 predicted 722
4 SASI_Rn02_00258087 predicted 764
5 SASI_Rn02_00258088 predicted 632
6 SASI_Rn02_00258089 predicted 232
7 SASI_Rn02_00258090 predicted 1851
8 SASI_Rn02_00258091 predicted 457
9 SASI_Rn02_00258092 predicted 1932
10 SASI_Rn02_00258093 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041495 predicted 435
2 SASI_Mm01_00041496 predicted 1914
3 SASI_Mm01_00041497 predicted 1344
4 SASI_Mm01_00041498 predicted 1429
5 SASI_Mm01_00041499 predicted 632
6 SASI_Mm01_00041500 predicted 1975
7 SASI_Mm01_00041501 predicted 1874
8 SASI_Mm02_00328898 predicted 1900
9 SASI_Mm02_00328899 predicted 744
10 SASI_Mm01_00041503 predicted 255
11 SASI_Mm01_00041494 predicted 296
12 SASI_Mm01_00041502 predicted 1940
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025714
VALIDATED
ODF2L MISSION shRNA Bacterial Glycerol Stock
outer dense fiber of sperm tails 2-like
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-685s1c1
Sequence:CCGGCGCCAAATTCAGAAGAGGGAACTCGAGTTCCCTCTTCTGAATTTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-447s21c1
Sequence:CCGGTAGCCTTAGAACATCTTATTACTCGAGTAATAAGATGTTCTAAGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025714.2-2037s1c1
Sequence:CCGGGCATTGAAGTCTAGTTTAATTCTCGAGAATTAAACTAGACTTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025714.4-1928s21c1
Sequence:CCGGAGGTTAGCAGTATTAGAATTTCTCGAGAAATTCTAATACTGCTAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-392s21c1
Sequence:CCGGTTTGAACAGAACGACATATTACTCGAGTAATATGTCGTTCTGTTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-671s21c1
Sequence:CCGGGATCGTCTACAGCGCCAAATTCTCGAGAATTTGGCGCTGTAGACGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-439s1c1
Sequence:CCGGCGTGTGAAATTAGCCTTAGAACTCGAGTTCTAAGGCTAATTTCACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025714.1-1993s1c1
Sequence:CCGGCTTTAAGGAATAGTAGCTCTTCTCGAGAAGAGCTACTATTCCTTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-1744s1c1
Sequence:CCGGGTTGACAAGATGAACACTAAACTCGAGTTTAGTGTTCATCTTGTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-1777s1c1
Sequence:CCGGGCTATCTGCTTGAAGGAAATACTCGAGTATTTCCTTCAAGCAGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-1216s1c1
Sequence:CCGGGAACTTGTAGAACTGCAAGAACTCGAGTTCTTGCAGTTCTACAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-541s1c1
Sequence:CCGGGAGAACAGAAACCTTGAGGAACTCGAGTTCCTCAAGGTTTCTGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-1863s21c1
Sequence:CCGGTTTCCTATGTAACGATGTTTACTCGAGTAAACATCGTTACATAGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025714
VALIDATED
ODF2L MISSION shRNA shRNA Plasmid DNA
outer dense fiber of sperm tails 2-like
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-685s1c1
Sequence:CCGGCGCCAAATTCAGAAGAGGGAACTCGAGTTCCCTCTTCTGAATTTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-447s21c1
Sequence:CCGGTAGCCTTAGAACATCTTATTACTCGAGTAATAAGATGTTCTAAGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025714.2-2037s1c1
Sequence:CCGGGCATTGAAGTCTAGTTTAATTCTCGAGAATTAAACTAGACTTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025714.4-1928s21c1
Sequence:CCGGAGGTTAGCAGTATTAGAATTTCTCGAGAAATTCTAATACTGCTAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-392s21c1
Sequence:CCGGTTTGAACAGAACGACATATTACTCGAGTAATATGTCGTTCTGTTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-671s21c1
Sequence:CCGGGATCGTCTACAGCGCCAAATTCTCGAGAATTTGGCGCTGTAGACGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-439s1c1
Sequence:CCGGCGTGTGAAATTAGCCTTAGAACTCGAGTTCTAAGGCTAATTTCACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025714.1-1993s1c1
Sequence:CCGGCTTTAAGGAATAGTAGCTCTTCTCGAGAAGAGCTACTATTCCTTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-1744s1c1
Sequence:CCGGGTTGACAAGATGAACACTAAACTCGAGTTTAGTGTTCATCTTGTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-1777s1c1
Sequence:CCGGGCTATCTGCTTGAAGGAAATACTCGAGTATTTCCTTCAAGCAGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-1216s1c1
Sequence:CCGGGAACTTGTAGAACTGCAAGAACTCGAGTTCTTGCAGTTCTACAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-541s1c1
Sequence:CCGGGAGAACAGAAACCTTGAGGAACTCGAGTTCCTCAAGGTTTCTGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-1863s21c1
Sequence:CCGGTTTCCTATGTAACGATGTTTACTCGAGTAAACATCGTTACATAGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025714
VALIDATED
ODF2L MISSION shRNA Lentiviral Transduction Particles
outer dense fiber of sperm tails 2-like
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-685s1c1
Sequence:CCGGCGCCAAATTCAGAAGAGGGAACTCGAGTTCCCTCTTCTGAATTTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-447s21c1
Sequence:CCGGTAGCCTTAGAACATCTTATTACTCGAGTAATAAGATGTTCTAAGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025714.2-2037s1c1
Sequence:CCGGGCATTGAAGTCTAGTTTAATTCTCGAGAATTAAACTAGACTTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025714.4-1928s21c1
Sequence:CCGGAGGTTAGCAGTATTAGAATTTCTCGAGAAATTCTAATACTGCTAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-392s21c1
Sequence:CCGGTTTGAACAGAACGACATATTACTCGAGTAATATGTCGTTCTGTTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-671s21c1
Sequence:CCGGGATCGTCTACAGCGCCAAATTCTCGAGAATTTGGCGCTGTAGACGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-439s1c1
Sequence:CCGGCGTGTGAAATTAGCCTTAGAACTCGAGTTCTAAGGCTAATTTCACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025714.1-1993s1c1
Sequence:CCGGCTTTAAGGAATAGTAGCTCTTCTCGAGAAGAGCTACTATTCCTTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-1744s1c1
Sequence:CCGGGTTGACAAGATGAACACTAAACTCGAGTTTAGTGTTCATCTTGTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-1777s1c1
Sequence:CCGGGCTATCTGCTTGAAGGAAATACTCGAGTATTTCCTTCAAGCAGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-1216s1c1
Sequence:CCGGGAACTTGTAGAACTGCAAGAACTCGAGTTCTTGCAGTTCTACAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025714.1-541s1c1
Sequence:CCGGGAGAACAGAAACCTTGAGGAACTCGAGTTCCTCAAGGTTTCTGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025714.4-1863s21c1
Sequence:CCGGTTTCCTATGTAACGATGTTTACTCGAGTAAACATCGTTACATAGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020729
VALIDATED
ODF2L MISSION shRNA Bacterial Glycerol Stock
outer dense fiber of sperm tails 2-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000139780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1749s1c1
Sequence:CCGGGAACACACCATTAGGGAGCTTCTCGAGAAGCTCCCTAATGGTGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1775s1c1
Sequence:CCGGCCAGGTTGATGGAAATCACAACTCGAGTTGTGATTTCCATCAACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1914s1c1
Sequence:CCGGGCAAACCAAGAAGAATGTCTTCTCGAGAAGACATTCTTCTTGGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-516s1c1
Sequence:CCGGGCGGAGTTGGTAACTCATTCTCTCGAGAGAATGAGTTACCAACTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-439s1c1
Sequence:CCGGCCAGTGAAAGTCATCTCAGCTCTCGAGAGCTGAGATGACTTTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1902s1c1
Sequence:CCGGGAGAAGAAGCTGGCAAACCAACTCGAGTTGGTTTGCCAGCTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1898s1c1
Sequence:CCGGGCTTGAGAAGAAGCTGGCAAACTCGAGTTTGCCAGCTTCTTCTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1410s1c1
Sequence:CCGGCTTGCTGCTTTGAAGGATGAACTCGAGTTCATCCTTCAAAGCAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-1926s1c1
Sequence:CCGGGAATGTCTTAAGCACAGCAATCTCGAGATTGCTGTGCTTAAGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1449s1c1
Sequence:CCGGGAACTCTCAGAATTGCAAGAACTCGAGTTCTTGCAATTCTGAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-1161s1c1
Sequence:CCGGGCCAAGTTGTCTGAAACAATTCTCGAGAATTGTTTCAGACAACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020729
VALIDATED
ODF2L MISSION shRNA shRNA Plasmid DNA
outer dense fiber of sperm tails 2-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000139780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1749s1c1
Sequence:CCGGGAACACACCATTAGGGAGCTTCTCGAGAAGCTCCCTAATGGTGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1775s1c1
Sequence:CCGGCCAGGTTGATGGAAATCACAACTCGAGTTGTGATTTCCATCAACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1914s1c1
Sequence:CCGGGCAAACCAAGAAGAATGTCTTCTCGAGAAGACATTCTTCTTGGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-516s1c1
Sequence:CCGGGCGGAGTTGGTAACTCATTCTCTCGAGAGAATGAGTTACCAACTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-439s1c1
Sequence:CCGGCCAGTGAAAGTCATCTCAGCTCTCGAGAGCTGAGATGACTTTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1902s1c1
Sequence:CCGGGAGAAGAAGCTGGCAAACCAACTCGAGTTGGTTTGCCAGCTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1898s1c1
Sequence:CCGGGCTTGAGAAGAAGCTGGCAAACTCGAGTTTGCCAGCTTCTTCTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1410s1c1
Sequence:CCGGCTTGCTGCTTTGAAGGATGAACTCGAGTTCATCCTTCAAAGCAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-1926s1c1
Sequence:CCGGGAATGTCTTAAGCACAGCAATCTCGAGATTGCTGTGCTTAAGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1449s1c1
Sequence:CCGGGAACTCTCAGAATTGCAAGAACTCGAGTTCTTGCAATTCTGAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-1161s1c1
Sequence:CCGGGCCAAGTTGTCTGAAACAATTCTCGAGAATTGTTTCAGACAACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020729
VALIDATED
ODF2L MISSION shRNA Lentiviral Transduction Particles
outer dense fiber of sperm tails 2-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000139780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1749s1c1
Sequence:CCGGGAACACACCATTAGGGAGCTTCTCGAGAAGCTCCCTAATGGTGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1775s1c1
Sequence:CCGGCCAGGTTGATGGAAATCACAACTCGAGTTGTGATTTCCATCAACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1914s1c1
Sequence:CCGGGCAAACCAAGAAGAATGTCTTCTCGAGAAGACATTCTTCTTGGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-516s1c1
Sequence:CCGGGCGGAGTTGGTAACTCATTCTCTCGAGAGAATGAGTTACCAACTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-439s1c1
Sequence:CCGGCCAGTGAAAGTCATCTCAGCTCTCGAGAGCTGAGATGACTTTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1902s1c1
Sequence:CCGGGAGAAGAAGCTGGCAAACCAACTCGAGTTGGTTTGCCAGCTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1898s1c1
Sequence:CCGGGCTTGAGAAGAAGCTGGCAAACTCGAGTTTGCCAGCTTCTTCTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1410s1c1
Sequence:CCGGCTTGCTGCTTTGAAGGATGAACTCGAGTTCATCCTTCAAAGCAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-1926s1c1
Sequence:CCGGGAATGTCTTAAGCACAGCAATCTCGAGATTGCTGTGCTTAAGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020729.1-1449s1c1
Sequence:CCGGGAACTCTCAGAATTGCAAGAACTCGAGTTCTTGCAATTCTGAGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020729.1-1161s1c1
Sequence:CCGGGCCAAGTTGTCTGAAACAATTCTCGAGAATTGTTTCAGACAACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)