EMAIL THIS PAGE TO A FRIEND

ODF3

outer dense fiber of sperm tails 3

74 Gene Product Result for
Synonyms: CT135 SHIPPO1 TISP50 hSHIPPO
UniProtKB ID: Q96PU9, Q69YX0
Gene ID:
Human(113746) Summary: ODF3 is a component of sperm flagella outer dense fibers, which add stiffness, elastic recoil, and protection against shearing forces during sperm movement.[supplied by OMIM, Apr 2004]
Mouse(69287) outer dense fiber of sperm tails 3
Rat(365387) outer dense fiber of sperm tails 3
sheep(101106212) outer dense fiber of sperm tails 3
naked mole-rat(101699464) outer dense fiber of sperm tails 3
domestic guinea pig(100731966) outer dense fiber of sperm tails 3
cow(509757) outer dense fiber of sperm tails 3
dog(483392) outer dense fiber of sperm tails 3
domestic cat(101081253) outer dense fiber of sperm tails 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053280 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134671 MISSION® esiRNA esiRNA human ODF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053280 Rosetta Predictions human pricing
NM_001108924 Rosetta Predictions rat pricing
NM_027019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162039 predicted 833
2 SASI_Hs01_00162040 predicted 600
3 SASI_Hs01_00162041 predicted 391
4 SASI_Hs01_00162042 predicted 339
5 SASI_Hs01_00162043 predicted 786
6 SASI_Hs02_00361916 predicted 847
7 SASI_Hs01_00162044 predicted 620
8 SASI_Hs02_00361917 predicted 599
9 SASI_Hs01_00162046 predicted 562
10 SASI_Hs01_00162047 predicted 629
11 SASI_Hs01_00162045 predicted 717
12 SASI_Hs01_00162048 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243424 predicted 236
2 SASI_Rn02_00243425 predicted 634
3 SASI_Rn02_00243426 predicted 858
4 SASI_Rn02_00243427 predicted 916
5 SASI_Rn02_00243428 predicted 501
6 SASI_Rn02_00243429 predicted 551
7 SASI_Rn02_00243430 predicted 649
8 SASI_Rn02_00243431 predicted 444
9 SASI_Rn02_00243432 predicted 842
10 SASI_Rn02_00243433 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331405 predicted 338
2 SASI_Mm01_00098771 predicted 511
3 SASI_Mm01_00098773 predicted 394
4 SASI_Mm02_00331406 predicted 569
5 SASI_Mm01_00098774 predicted 302
6 SASI_Mm02_00331407 predicted 560
7 SASI_Mm02_00331408 predicted 538
8 SASI_Mm01_00098776 predicted 356
9 SASI_Mm01_00098778 predicted 591
10 SASI_Mm02_00331409 predicted 442
11 SASI_Mm01_00098770 predicted 291
12 SASI_Mm01_00098772 predicted 615
13 SASI_Mm01_00098775 predicted 850
14 SASI_Mm01_00098777 predicted 840
15 SASI_Mm01_00098779 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027019
ODF3 MISSION shRNA Bacterial Glycerol Stock
outer dense fiber of sperm tails 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-862s1c1
Sequence:CCGGCCTTGGTTGTCGATGTGGAATCTCGAGATTCCACATCGACAACCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-430s1c1
Sequence:CCGGGTGATTACTTTCCAGAGAAATCTCGAGATTTCTCTGGAAAGTAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-849s1c1
Sequence:CCGGGACTACATGACACCCTTGGTTCTCGAGAACCAAGGGTGTCATGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-427s1c1
Sequence:CCGGCGGGTGATTACTTTCCAGAGACTCGAGTCTCTGGAAAGTAATCACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-441s1c1
Sequence:CCGGCCAGAGAAATCTACCAAGTATCTCGAGATACTTGGTAGATTTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027019
ODF3 MISSION shRNA shRNA Plasmid DNA
outer dense fiber of sperm tails 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-862s1c1
Sequence:CCGGCCTTGGTTGTCGATGTGGAATCTCGAGATTCCACATCGACAACCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-430s1c1
Sequence:CCGGGTGATTACTTTCCAGAGAAATCTCGAGATTTCTCTGGAAAGTAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-849s1c1
Sequence:CCGGGACTACATGACACCCTTGGTTCTCGAGAACCAAGGGTGTCATGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-427s1c1
Sequence:CCGGCGGGTGATTACTTTCCAGAGACTCGAGTCTCTGGAAAGTAATCACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-441s1c1
Sequence:CCGGCCAGAGAAATCTACCAAGTATCTCGAGATACTTGGTAGATTTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027019
ODF3 MISSION shRNA Lentiviral Transduction Particles
outer dense fiber of sperm tails 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-862s1c1
Sequence:CCGGCCTTGGTTGTCGATGTGGAATCTCGAGATTCCACATCGACAACCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-430s1c1
Sequence:CCGGGTGATTACTTTCCAGAGAAATCTCGAGATTTCTCTGGAAAGTAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-849s1c1
Sequence:CCGGGACTACATGACACCCTTGGTTCTCGAGAACCAAGGGTGTCATGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-427s1c1
Sequence:CCGGCGGGTGATTACTTTCCAGAGACTCGAGTCTCTGGAAAGTAATCACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027019.1-441s1c1
Sequence:CCGGCCAGAGAAATCTACCAAGTATCTCGAGATACTTGGTAGATTTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053280
ODF3 MISSION shRNA Bacterial Glycerol Stock
outer dense fiber of sperm tails 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-398s1c1
Sequence:CCGGCAACAGGCTTCATGAAGCACACTCGAGTGTGCTTCATGAAGCCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-516s1c1
Sequence:CCGGCAAGATACTGAGGACTGGCAACTCGAGTTGCCAGTCCTCAGTATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-1011s1c1
Sequence:CCGGCATCAAACACTCTGATTACATCTCGAGATGTAATCAGAGTGTTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-612s1c1
Sequence:CCGGCTTTCCAGAGAAATCCACCAACTCGAGTTGGTGGATTTCTCTGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-387s1c1
Sequence:CCGGGATTCCACCAACAACAGGCTTCTCGAGAAGCCTGTTGTTGGTGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053280.3-1040s21c1
Sequence:CCGGTGCTGGTTGATGTGGAATAACCTCGAGGTTATTCCACATCAACCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053280.3-567s21c1
Sequence:CCGGGCGCTACCAAACCAAGACCATCTCGAGATGGTCTTGGTTTGGTAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053280.3-1173s21c1
Sequence:CCGGAGCACGCTTGTTTGGGCAATTCTCGAGAATTGCCCAAACAAGCGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053280.3-875s21c1
Sequence:CCGGAGTTCAAGGCTCCGCAGTACACTCGAGTGTACTGCGGAGCCTTGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053280
ODF3 MISSION shRNA shRNA Plasmid DNA
outer dense fiber of sperm tails 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-398s1c1
Sequence:CCGGCAACAGGCTTCATGAAGCACACTCGAGTGTGCTTCATGAAGCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-516s1c1
Sequence:CCGGCAAGATACTGAGGACTGGCAACTCGAGTTGCCAGTCCTCAGTATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-1011s1c1
Sequence:CCGGCATCAAACACTCTGATTACATCTCGAGATGTAATCAGAGTGTTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-612s1c1
Sequence:CCGGCTTTCCAGAGAAATCCACCAACTCGAGTTGGTGGATTTCTCTGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-387s1c1
Sequence:CCGGGATTCCACCAACAACAGGCTTCTCGAGAAGCCTGTTGTTGGTGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053280.3-1040s21c1
Sequence:CCGGTGCTGGTTGATGTGGAATAACCTCGAGGTTATTCCACATCAACCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053280.3-567s21c1
Sequence:CCGGGCGCTACCAAACCAAGACCATCTCGAGATGGTCTTGGTTTGGTAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053280.3-1173s21c1
Sequence:CCGGAGCACGCTTGTTTGGGCAATTCTCGAGAATTGCCCAAACAAGCGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053280.3-875s21c1
Sequence:CCGGAGTTCAAGGCTCCGCAGTACACTCGAGTGTACTGCGGAGCCTTGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053280
ODF3 MISSION shRNA Lentiviral Transduction Particles
outer dense fiber of sperm tails 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-398s1c1
Sequence:CCGGCAACAGGCTTCATGAAGCACACTCGAGTGTGCTTCATGAAGCCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-516s1c1
Sequence:CCGGCAAGATACTGAGGACTGGCAACTCGAGTTGCCAGTCCTCAGTATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-1011s1c1
Sequence:CCGGCATCAAACACTCTGATTACATCTCGAGATGTAATCAGAGTGTTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-612s1c1
Sequence:CCGGCTTTCCAGAGAAATCCACCAACTCGAGTTGGTGGATTTCTCTGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053280.3-387s1c1
Sequence:CCGGGATTCCACCAACAACAGGCTTCTCGAGAAGCCTGTTGTTGGTGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053280.3-1040s21c1
Sequence:CCGGTGCTGGTTGATGTGGAATAACCTCGAGGTTATTCCACATCAACCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053280.3-567s21c1
Sequence:CCGGGCGCTACCAAACCAAGACCATCTCGAGATGGTCTTGGTTTGGTAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053280.3-1173s21c1
Sequence:CCGGAGCACGCTTGTTTGGGCAATTCTCGAGAATTGCCCAAACAAGCGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053280.3-875s21c1
Sequence:CCGGAGTTCAAGGCTCCGCAGTACACTCGAGTGTACTGCGGAGCCTTGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)