EMAIL THIS PAGE TO A FRIEND

OGDH

oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)

73 Gene Product Result for
Synonyms: AKGDH E1k OGDC
UniProtKB ID: Q02218, B4E2U9, D3DVL0, E9PBM1, Q96DD3, Q9UDX0
Gene ID:
Human(4967) Summary: This gene encodes one subunit of the 2-oxoglutarate dehydrogenase complex. This complex catalyzes the overall conversion of 2-oxoglutarate (alpha-ketoglutarate) to succinyl-CoA and CO(2) during the Krebs cycle. The protein is located in the mitochondrial matrix and uses thiamine pyrophosphate as a cofactor. A congenital deficiency in 2-oxoglutarate dehydrogenase activity is believed to lead to hypotonia, metabolic acidosis, and hyperlactatemia. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
Mouse(18293) oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Rat(360975) oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
chicken(426429) oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
cow(534599) oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
domestic cat(101096048) oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
dog(475499) oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
domestic guinea pig(100724083) oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
naked mole-rat(101716205) oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Domestic Rabbit(100359048) oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
sheep(101115360) oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK189 A-KG Dehydrogenase Activity Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002541 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003941 Rosetta Predictions human pricing
NM_002541 Rosetta Predictions human pricing
NM_001017461 Rosetta Predictions rat pricing
NM_010956 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171350 predicted 1000
2 SASI_Hs01_00171351 predicted 610
3 SASI_Hs01_00171353 predicted 1083
4 SASI_Hs01_00171354 predicted 925
5 SASI_Hs01_00171355 predicted 927
6 SASI_Hs01_00171356 predicted 842
7 SASI_Hs01_00171357 predicted 955
8 SASI_Hs01_00171358 predicted 664
9 SASI_Hs01_00171359 predicted 824
10 SASI_Hs02_00304430 predicted 590
11 SASI_Hs01_00171352 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196428 predicted 999
2 SASI_Hs01_00196429 predicted 607
3 SASI_Hs01_00196431 predicted 1085
4 SASI_Hs01_00196432 predicted 923
5 SASI_Hs01_00196433 predicted 920
6 SASI_Hs01_00196434 predicted 839
7 SASI_Hs01_00196435 predicted 957
8 SASI_Hs01_00196436 predicted 661
9 SASI_Hs01_00196437 predicted 828
10 SASI_Hs02_00334029 predicted 591
11 SASI_Hs01_00196430 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110030 predicted 580
2 SASI_Rn01_00110031 predicted 2998
3 SASI_Rn01_00110033 predicted 946
4 SASI_Rn01_00110034 predicted 1131
5 SASI_Rn01_00110035 predicted 2370
6 SASI_Rn02_00202257 predicted 1516
7 SASI_Rn01_00110036 predicted 952
8 SASI_Rn01_00110037 predicted 3010
9 SASI_Rn01_00110038 predicted 1741
10 SASI_Rn01_00110039 predicted 848
11 SASI_Rn01_00110032 predicted 2965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010956 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096272 predicted 3007
2 SASI_Mm01_00096273 predicted 1614
3 SASI_Mm01_00096274 predicted 1732
4 SASI_Mm02_00319713 predicted 1787
5 SASI_Mm01_00096275 predicted 846
6 SASI_Mm01_00096277 predicted 1171
7 SASI_Mm01_00096279 predicted 1847
8 SASI_Mm01_00096280 predicted 1659
9 SASI_Mm01_00096281 predicted 2907
10 SASI_Mm02_00319714 predicted 2223
11 SASI_Mm01_00096276 predicted 3057
12 SASI_Mm01_00096278 predicted 687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010956
VALIDATED
OGDH MISSION shRNA Bacterial Glycerol Stock
oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-218s1c1
Sequence:CCGGCCAGCAGCAATTAGGACGTTTCTCGAGAAACGTCCTAATTGCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-3169s1c1
Sequence:CCGGCCTGGACGCATTCAAGAAATTCTCGAGAATTTCTTGAATGCGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-2720s1c1
Sequence:CCGGCCTGAGGCAAGAACTAGCTTTCTCGAGAAAGCTAGTTCTTGCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-1637s1c1
Sequence:CCGGCTGGTGTGTTATCGACGAAATCTCGAGATTTCGTCGATAACACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010956.1-581s1c1
Sequence:CCGGCCTCTCGGAATTAGTTGTGTACTCGAGTACACAACTAATTCCGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-3239s21c1
Sequence:CCGGGCTCTTTGCTTCTCAACTAAACTCGAGTTTAGTTGAGAAGCAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-470s21c1
Sequence:CCGGCACAACCTAACGTCGACAAACCTCGAGGTTTGTCGACGTTAGGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-1636s21c1
Sequence:CCGGCTGGTGTGTTATCGACGAAATCTCGAGATTTCGTCGATAACACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-3168s21c1
Sequence:CCGGCCTGGACGCATTCAAGAAATTCTCGAGAATTTCTTGAATGCGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-1794s21c1
Sequence:CCGGGGAAATCTCCAAGTATGATAACTCGAGTTATCATACTTGGAGATTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010956
VALIDATED
OGDH MISSION shRNA shRNA Plasmid DNA
oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-218s1c1
Sequence:CCGGCCAGCAGCAATTAGGACGTTTCTCGAGAAACGTCCTAATTGCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-3169s1c1
Sequence:CCGGCCTGGACGCATTCAAGAAATTCTCGAGAATTTCTTGAATGCGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-2720s1c1
Sequence:CCGGCCTGAGGCAAGAACTAGCTTTCTCGAGAAAGCTAGTTCTTGCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-1637s1c1
Sequence:CCGGCTGGTGTGTTATCGACGAAATCTCGAGATTTCGTCGATAACACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010956.1-581s1c1
Sequence:CCGGCCTCTCGGAATTAGTTGTGTACTCGAGTACACAACTAATTCCGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-3239s21c1
Sequence:CCGGGCTCTTTGCTTCTCAACTAAACTCGAGTTTAGTTGAGAAGCAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-470s21c1
Sequence:CCGGCACAACCTAACGTCGACAAACCTCGAGGTTTGTCGACGTTAGGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-1636s21c1
Sequence:CCGGCTGGTGTGTTATCGACGAAATCTCGAGATTTCGTCGATAACACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-3168s21c1
Sequence:CCGGCCTGGACGCATTCAAGAAATTCTCGAGAATTTCTTGAATGCGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-1794s21c1
Sequence:CCGGGGAAATCTCCAAGTATGATAACTCGAGTTATCATACTTGGAGATTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010956
VALIDATED
OGDH MISSION shRNA Lentiviral Transduction Particles
oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-218s1c1
Sequence:CCGGCCAGCAGCAATTAGGACGTTTCTCGAGAAACGTCCTAATTGCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-3169s1c1
Sequence:CCGGCCTGGACGCATTCAAGAAATTCTCGAGAATTTCTTGAATGCGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-2720s1c1
Sequence:CCGGCCTGAGGCAAGAACTAGCTTTCTCGAGAAAGCTAGTTCTTGCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010956.1-1637s1c1
Sequence:CCGGCTGGTGTGTTATCGACGAAATCTCGAGATTTCGTCGATAACACACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010956.1-581s1c1
Sequence:CCGGCCTCTCGGAATTAGTTGTGTACTCGAGTACACAACTAATTCCGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-3239s21c1
Sequence:CCGGGCTCTTTGCTTCTCAACTAAACTCGAGTTTAGTTGAGAAGCAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-470s21c1
Sequence:CCGGCACAACCTAACGTCGACAAACCTCGAGGTTTGTCGACGTTAGGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-1636s21c1
Sequence:CCGGCTGGTGTGTTATCGACGAAATCTCGAGATTTCGTCGATAACACACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-3168s21c1
Sequence:CCGGCCTGGACGCATTCAAGAAATTCTCGAGAATTTCTTGAATGCGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010956.3-1794s21c1
Sequence:CCGGGGAAATCTCCAAGTATGATAACTCGAGTTATCATACTTGGAGATTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002541
VALIDATED
OGDH MISSION shRNA Bacterial Glycerol Stock
oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_002541.1-1714s1c1
Sequence:CCGGCCTGAGTATGAGGAGGAAATTCTCGAGAATTTCCTCCTCATACTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002541.1-448s1c1
Sequence:CCGGCAGTCACTCATCAGGGCATATCTCGAGATATGCCCTGATGAGTGACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002541.1-2956s1c1
Sequence:CCGGGACTACGTGAAGCCAAGACTTCTCGAGAAGTCTTGGCTTCACGTAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002541.1-1501s1c1
Sequence:CCGGGCTGTCATGTACGTGTGCAAACTCGAGTTTGCACACGTACATGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002541.1-2497s1c1
Sequence:CCGGGAAGCCAACTTCGACATCAATCTCGAGATTGATGTCGAAGTTGGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002541.3-2353s21c1
Sequence:CCGGTTCGCCATGGCCAGTCCTAATCTCGAGATTAGGACTGGCCATGGCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002541.3-2705s21c1
Sequence:CCGGCATTCCGGAAGCCGTTAATTACTCGAGTAATTAACGGCTTCCGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002541.3-1147s21c1
Sequence:CCGGTTCTGTCAATTCGATTCAAAGCTCGAGCTTTGAATCGAATTGACAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002541.3-3607s21c1
Sequence:CCGGAGGCACAGGCTCCTGTATTTGCTCGAGCAAATACAGGAGCCTGTGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002541
VALIDATED
OGDH MISSION shRNA shRNA Plasmid DNA
oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_002541.1-1714s1c1
Sequence:CCGGCCTGAGTATGAGGAGGAAATTCTCGAGAATTTCCTCCTCATACTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002541.1-448s1c1
Sequence:CCGGCAGTCACTCATCAGGGCATATCTCGAGATATGCCCTGATGAGTGACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002541.1-2956s1c1
Sequence:CCGGGACTACGTGAAGCCAAGACTTCTCGAGAAGTCTTGGCTTCACGTAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002541.1-1501s1c1
Sequence:CCGGGCTGTCATGTACGTGTGCAAACTCGAGTTTGCACACGTACATGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002541.1-2497s1c1
Sequence:CCGGGAAGCCAACTTCGACATCAATCTCGAGATTGATGTCGAAGTTGGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002541.3-2353s21c1
Sequence:CCGGTTCGCCATGGCCAGTCCTAATCTCGAGATTAGGACTGGCCATGGCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002541.3-2705s21c1
Sequence:CCGGCATTCCGGAAGCCGTTAATTACTCGAGTAATTAACGGCTTCCGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002541.3-1147s21c1
Sequence:CCGGTTCTGTCAATTCGATTCAAAGCTCGAGCTTTGAATCGAATTGACAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002541.3-3607s21c1
Sequence:CCGGAGGCACAGGCTCCTGTATTTGCTCGAGCAAATACAGGAGCCTGTGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002541
VALIDATED
OGDH MISSION shRNA Lentiviral Transduction Particles
oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_002541.1-1714s1c1
Sequence:CCGGCCTGAGTATGAGGAGGAAATTCTCGAGAATTTCCTCCTCATACTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002541.1-448s1c1
Sequence:CCGGCAGTCACTCATCAGGGCATATCTCGAGATATGCCCTGATGAGTGACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002541.1-2956s1c1
Sequence:CCGGGACTACGTGAAGCCAAGACTTCTCGAGAAGTCTTGGCTTCACGTAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002541.1-1501s1c1
Sequence:CCGGGCTGTCATGTACGTGTGCAAACTCGAGTTTGCACACGTACATGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002541.1-2497s1c1
Sequence:CCGGGAAGCCAACTTCGACATCAATCTCGAGATTGATGTCGAAGTTGGCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002541.3-2353s21c1
Sequence:CCGGTTCGCCATGGCCAGTCCTAATCTCGAGATTAGGACTGGCCATGGCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002541.3-2705s21c1
Sequence:CCGGCATTCCGGAAGCCGTTAATTACTCGAGTAATTAACGGCTTCCGGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002541.3-1147s21c1
Sequence:CCGGTTCTGTCAATTCGATTCAAAGCTCGAGCTTTGAATCGAATTGACAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002541.3-3607s21c1
Sequence:CCGGAGGCACAGGCTCCTGTATTTGCTCGAGCAAATACAGGAGCCTGTGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)