EMAIL THIS PAGE TO A FRIEND

OGFOD2

2-oxoglutarate and iron-dependent oxygenase domain containing 2

47 Gene Product Result for
UniProtKB ID: Q6N063, B3KT24, Q4KN13, Q6N023, Q9H8K6
Gene ID:
Mouse(66627) 2-oxoglutarate and iron-dependent oxygenase domain containing 2
Rat(288657) 2-oxoglutarate and iron-dependent oxygenase domain containing 2
chicken(416832) 2-oxoglutarate and iron-dependent oxygenase domain containing 2
cow(539407) 2-oxoglutarate and iron-dependent oxygenase domain containing 2
domestic cat(101087874) 2-oxoglutarate and iron-dependent oxygenase domain containing 2
dog(477455) 2-oxoglutarate and iron-dependent oxygenase domain containing 2
sheep(101118989) 2-oxoglutarate and iron-dependent oxygenase domain containing 2
naked mole-rat(101716810) 2-oxoglutarate and iron-dependent oxygenase domain containing 2
domestic guinea pig(100722219) 2-oxoglutarate and iron-dependent oxygenase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024623 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072761 MISSION® esiRNA esiRNA human OGFOD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024623 Rosetta Predictions human pricing
NM_001105927 Rosetta Predictions rat pricing
NM_025671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357003 predicted 929
2 SASI_Hs01_00211901 predicted 1262
3 SASI_Hs01_00211902 predicted 737
4 SASI_Hs01_00211903 predicted 806
5 SASI_Hs01_00211904 predicted 555
6 SASI_Hs01_00211906 predicted 1326
7 SASI_Hs01_00211907 predicted 575
8 SASI_Hs01_00211908 predicted 738
9 SASI_Hs01_00211909 predicted 811
10 SASI_Hs01_00211910 predicted 650
11 SASI_Hs01_00211905 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213912 predicted 365
2 SASI_Rn02_00213913 predicted 1148
3 SASI_Rn02_00213914 predicted 974
4 SASI_Rn02_00213915 predicted 1041
5 SASI_Rn02_00213916 predicted 1180
6 SASI_Rn02_00213917 predicted 1170
7 SASI_Rn02_00213918 predicted 1034
8 SASI_Rn02_00213919 predicted 1197
9 SASI_Rn02_00213920 predicted 939
10 SASI_Rn02_00213921 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095080 predicted 242
2 SASI_Mm01_00095081 predicted 1024
3 SASI_Mm01_00095082 predicted 1191
4 SASI_Mm01_00095083 predicted 352
5 SASI_Mm01_00095084 predicted 1187
6 SASI_Mm01_00095086 predicted 1177
7 SASI_Mm01_00095087 predicted 722
8 SASI_Mm01_00095088 predicted 813
9 SASI_Mm01_00095089 predicted 419
10 SASI_Mm02_00328809 predicted 417
11 SASI_Mm01_00095085 predicted 699
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025671
OGFOD2 MISSION shRNA Bacterial Glycerol Stock
2-oxoglutarate and iron-dependent oxygenase domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-986s21c1
Sequence:CCGGAGGGTTTCGGTGACGGCTTTACTCGAGTAAAGCCGTCACCGAAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025671.2-1339s1c1
Sequence:CCGGCAGACATCTACCTTAGGTAAACTCGAGTTTACCTAAGGTAGATGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025671.2-527s1c1
Sequence:CCGGGGGTACTGATGTATGAACTAGCTCGAGCTAGTTCATACATCAGTACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-323s21c1
Sequence:CCGGTTATGGCTGCAGCTGAATATACTCGAGTATATTCAGCTGCAGCCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-691s21c1
Sequence:CCGGCTGGGCTGTCACTACGATAATCTCGAGATTATCGTAGTGACAGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-919s21c1
Sequence:CCGGCGGGCATCTGCTGTTCGAAATCTCGAGATTTCGAACAGCAGATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025671.2-1340s21c1
Sequence:CCGGAGACATCTACCTTAGGTAAAGCTCGAGCTTTACCTAAGGTAGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025671.1-655s1c1
Sequence:CCGGCTTTGTGGTCAAGTACGCACTCTCGAGAGTGCGTACTTGACCACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025671
OGFOD2 MISSION shRNA shRNA Plasmid DNA
2-oxoglutarate and iron-dependent oxygenase domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-986s21c1
Sequence:CCGGAGGGTTTCGGTGACGGCTTTACTCGAGTAAAGCCGTCACCGAAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025671.2-1339s1c1
Sequence:CCGGCAGACATCTACCTTAGGTAAACTCGAGTTTACCTAAGGTAGATGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025671.2-527s1c1
Sequence:CCGGGGGTACTGATGTATGAACTAGCTCGAGCTAGTTCATACATCAGTACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-323s21c1
Sequence:CCGGTTATGGCTGCAGCTGAATATACTCGAGTATATTCAGCTGCAGCCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-691s21c1
Sequence:CCGGCTGGGCTGTCACTACGATAATCTCGAGATTATCGTAGTGACAGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-919s21c1
Sequence:CCGGCGGGCATCTGCTGTTCGAAATCTCGAGATTTCGAACAGCAGATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025671.2-1340s21c1
Sequence:CCGGAGACATCTACCTTAGGTAAAGCTCGAGCTTTACCTAAGGTAGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025671.1-655s1c1
Sequence:CCGGCTTTGTGGTCAAGTACGCACTCTCGAGAGTGCGTACTTGACCACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025671
OGFOD2 MISSION shRNA Lentiviral Transduction Particles
2-oxoglutarate and iron-dependent oxygenase domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-986s21c1
Sequence:CCGGAGGGTTTCGGTGACGGCTTTACTCGAGTAAAGCCGTCACCGAAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025671.2-1339s1c1
Sequence:CCGGCAGACATCTACCTTAGGTAAACTCGAGTTTACCTAAGGTAGATGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025671.2-527s1c1
Sequence:CCGGGGGTACTGATGTATGAACTAGCTCGAGCTAGTTCATACATCAGTACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-323s21c1
Sequence:CCGGTTATGGCTGCAGCTGAATATACTCGAGTATATTCAGCTGCAGCCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-691s21c1
Sequence:CCGGCTGGGCTGTCACTACGATAATCTCGAGATTATCGTAGTGACAGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025671.2-919s21c1
Sequence:CCGGCGGGCATCTGCTGTTCGAAATCTCGAGATTTCGAACAGCAGATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025671.2-1340s21c1
Sequence:CCGGAGACATCTACCTTAGGTAAAGCTCGAGCTTTACCTAAGGTAGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025671.1-655s1c1
Sequence:CCGGCTTTGTGGTCAAGTACGCACTCTCGAGAGTGCGTACTTGACCACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024623
VALIDATED
OGFOD2 MISSION shRNA Bacterial Glycerol Stock
2-oxoglutarate and iron-dependent oxygenase domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-611s1c1
Sequence:CCGGGCCTGAGGTCTACGACTCACTCTCGAGAGTGAGTCGTAGACCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-1360s1c1
Sequence:CCGGCGGTGGATGTATGTGCGCTCACTCGAGTGAGCGCACATACATCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-812s1c1
Sequence:CCGGCGAGCAATCGGACATGCCTAACTCGAGTTAGGCATGTCCGATTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-1034s1c1
Sequence:CCGGCCACTATGATAATGCCGAGCTCTCGAGAGCTCGGCATTATCATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-987s1c1
Sequence:CCGGGCCTTTGTGGTCAAATACGCACTCGAGTGCGTATTTGACCACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024623
VALIDATED
OGFOD2 MISSION shRNA shRNA Plasmid DNA
2-oxoglutarate and iron-dependent oxygenase domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-611s1c1
Sequence:CCGGGCCTGAGGTCTACGACTCACTCTCGAGAGTGAGTCGTAGACCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-1360s1c1
Sequence:CCGGCGGTGGATGTATGTGCGCTCACTCGAGTGAGCGCACATACATCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-812s1c1
Sequence:CCGGCGAGCAATCGGACATGCCTAACTCGAGTTAGGCATGTCCGATTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-1034s1c1
Sequence:CCGGCCACTATGATAATGCCGAGCTCTCGAGAGCTCGGCATTATCATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-987s1c1
Sequence:CCGGGCCTTTGTGGTCAAATACGCACTCGAGTGCGTATTTGACCACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024623
VALIDATED
OGFOD2 MISSION shRNA Lentiviral Transduction Particles
2-oxoglutarate and iron-dependent oxygenase domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-611s1c1
Sequence:CCGGGCCTGAGGTCTACGACTCACTCTCGAGAGTGAGTCGTAGACCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-1360s1c1
Sequence:CCGGCGGTGGATGTATGTGCGCTCACTCGAGTGAGCGCACATACATCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-812s1c1
Sequence:CCGGCGAGCAATCGGACATGCCTAACTCGAGTTAGGCATGTCCGATTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-1034s1c1
Sequence:CCGGCCACTATGATAATGCCGAGCTCTCGAGAGCTCGGCATTATCATAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024623.1-987s1c1
Sequence:CCGGGCCTTTGTGGTCAAATACGCACTCGAGTGCGTATTTGACCACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)