EMAIL THIS PAGE TO A FRIEND

OGFR

opioid growth factor receptor

49 Gene Product Result for
Gene ID:
Human(11054) Summary: The protein encoded by this gene is a receptor for opioid growth factor (OGF), also known as [Met(5)]
Mouse(72075) opioid growth factor receptor
Rat(83525) opioid growth factor receptor
Zebrafish(321658) opioid growth factor receptor
chicken(428150) opioid growth factor receptor
cow(767947) opioid growth factor receptor
domestic cat(101082141) opioid growth factor receptor
dog(485964) opioid growth factor receptor
sheep(101120430) opioid growth factor receptor
naked mole-rat(101706934) opioid growth factor receptor
domestic guinea pig(100718551) opioid growth factor receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007346 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007346 Rosetta Predictions human pricing
NM_053340 Rosetta Predictions rat pricing
NM_031373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056011 predicted 353
2 SASI_Hs01_00056012 predicted 2050
3 SASI_Hs01_00056014 predicted 846
4 SASI_Hs01_00056015 predicted 2158
5 SASI_Hs01_00056016 predicted 693
6 SASI_Hs01_00056017 predicted 371
7 SASI_Hs01_00056019 predicted 1252
8 SASI_Hs02_00343434 predicted 354
9 SASI_Hs01_00056010 predicted 388
10 SASI_Hs02_00343435 predicted 2046
11 SASI_Hs01_00056013 predicted 2047
12 SASI_Hs01_00056018 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098618 predicted 349
2 SASI_Rn01_00098619 predicted 316
3 SASI_Rn01_00098620 predicted 641
4 SASI_Rn01_00098621 predicted 1217
5 SASI_Rn01_00098622 predicted 1329
6 SASI_Rn01_00098623 predicted 534
7 SASI_Rn01_00098624 predicted 981
8 SASI_Rn01_00098626 predicted 638
9 SASI_Rn02_00265796 predicted 1855
10 SASI_Rn01_00098627 predicted 1854
11 SASI_Rn01_00098625 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030913 predicted 852
2 SASI_Mm01_00030914 predicted 510
3 SASI_Mm01_00030915 predicted 219
4 SASI_Mm01_00030916 predicted 607
5 SASI_Mm01_00030917 predicted 1844
6 SASI_Mm01_00030918 predicted 299
7 SASI_Mm01_00030919 predicted 799
8 SASI_Mm01_00030920 predicted 1970
9 SASI_Mm02_00337113 predicted 224
10 SASI_Mm01_00030922 predicted 295
11 SASI_Mm01_00030921 predicted 290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007346
OGFR MISSION shRNA Bacterial Glycerol Stock
opioid growth factor receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007346.2-445s21c1
Sequence:CCGGTGCGAGAACCAGGAGTGAACTCTCGAGAGTTCACTCCTGGTTCTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007346.2-787s21c1
Sequence:CCGGAGAGTGCCCTGGACTACTTCACTCGAGTGAAGTAGTCCAGGGCACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007346.2-378s21c1
Sequence:CCGGCAGAACTGGACGGACAACTATCTCGAGATAGTTGTCCGTCCAGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-353s1c1
Sequence:CCGGCGGCTGTTTCATTGAGGACATCTCGAGATGTCCTCAATGAAACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-668s1c1
Sequence:CCGGCCGCATCACACGCATCCTCAACTCGAGTTGAGGATGCGTGTGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-1255s1c1
Sequence:CCGGTGGAGAAGATCGCTCTGAATTCTCGAGAATTCAGAGCGATCTTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-404s1c1
Sequence:CCGGCCTTGAGGACAATCACTCCTACTCGAGTAGGAGTGATTGTCCTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-248s1c1
Sequence:CCGGCATGTGTAGGTATCGGCACAACTCGAGTTGTGCCGATACCTACACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007346
OGFR MISSION shRNA shRNA Plasmid DNA
opioid growth factor receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007346.2-445s21c1
Sequence:CCGGTGCGAGAACCAGGAGTGAACTCTCGAGAGTTCACTCCTGGTTCTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007346.2-787s21c1
Sequence:CCGGAGAGTGCCCTGGACTACTTCACTCGAGTGAAGTAGTCCAGGGCACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007346.2-378s21c1
Sequence:CCGGCAGAACTGGACGGACAACTATCTCGAGATAGTTGTCCGTCCAGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-353s1c1
Sequence:CCGGCGGCTGTTTCATTGAGGACATCTCGAGATGTCCTCAATGAAACAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-668s1c1
Sequence:CCGGCCGCATCACACGCATCCTCAACTCGAGTTGAGGATGCGTGTGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-1255s1c1
Sequence:CCGGTGGAGAAGATCGCTCTGAATTCTCGAGAATTCAGAGCGATCTTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-404s1c1
Sequence:CCGGCCTTGAGGACAATCACTCCTACTCGAGTAGGAGTGATTGTCCTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-248s1c1
Sequence:CCGGCATGTGTAGGTATCGGCACAACTCGAGTTGTGCCGATACCTACACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007346
OGFR MISSION shRNA Lentiviral Transduction Particles
opioid growth factor receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007346.2-445s21c1
Sequence:CCGGTGCGAGAACCAGGAGTGAACTCTCGAGAGTTCACTCCTGGTTCTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007346.2-787s21c1
Sequence:CCGGAGAGTGCCCTGGACTACTTCACTCGAGTGAAGTAGTCCAGGGCACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007346.2-378s21c1
Sequence:CCGGCAGAACTGGACGGACAACTATCTCGAGATAGTTGTCCGTCCAGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-353s1c1
Sequence:CCGGCGGCTGTTTCATTGAGGACATCTCGAGATGTCCTCAATGAAACAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-668s1c1
Sequence:CCGGCCGCATCACACGCATCCTCAACTCGAGTTGAGGATGCGTGTGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-1255s1c1
Sequence:CCGGTGGAGAAGATCGCTCTGAATTCTCGAGAATTCAGAGCGATCTTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-404s1c1
Sequence:CCGGCCTTGAGGACAATCACTCCTACTCGAGTAGGAGTGATTGTCCTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007346.2-248s1c1
Sequence:CCGGCATGTGTAGGTATCGGCACAACTCGAGTTGTGCCGATACCTACACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031373
VALIDATED
OGFR MISSION shRNA Bacterial Glycerol Stock
opioid growth factor receptor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031373.2-206s21c1
Sequence:CCGGGCAAAGATACCGGCACAACTACTCGAGTAGTTGTGCCGGTATCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031373.2-1973s21c1
Sequence:CCGGGCTCTGTTGTTGGCTCTTCTTCTCGAGAAGAAGAGCCAACAACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031373.2-1270s21c1
Sequence:CCGGTTGTGGCTAGGGTGGCTAATGCTCGAGCATTAGCCACCCTAGCCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031373.2-158s21c1
Sequence:CCGGCCAGTCTAGGATGACAAGGTACTCGAGTACCTTGTCATCCTAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031373.2-610s21c1
Sequence:CCGGGCCACAACAATCTGCGTATTACTCGAGTAATACGCAGATTGTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-1973s1c1
Sequence:CCGGGCTCTGTTGTTGGCTCTTCTTCTCGAGAAGAAGAGCCAACAACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-158s1c1
Sequence:CCGGCCAGTCTAGGATGACAAGGTACTCGAGTACCTTGTCATCCTAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-610s1c1
Sequence:CCGGGCCACAACAATCTGCGTATTACTCGAGTAATACGCAGATTGTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-206s1c1
Sequence:CCGGGCAAAGATACCGGCACAACTACTCGAGTAGTTGTGCCGGTATCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-609s1c1
Sequence:CCGGAGCCACAACAATCTGCGTATTCTCGAGAATACGCAGATTGTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031373
VALIDATED
OGFR MISSION shRNA shRNA Plasmid DNA
opioid growth factor receptor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031373.2-206s21c1
Sequence:CCGGGCAAAGATACCGGCACAACTACTCGAGTAGTTGTGCCGGTATCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031373.2-1973s21c1
Sequence:CCGGGCTCTGTTGTTGGCTCTTCTTCTCGAGAAGAAGAGCCAACAACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031373.2-1270s21c1
Sequence:CCGGTTGTGGCTAGGGTGGCTAATGCTCGAGCATTAGCCACCCTAGCCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031373.2-158s21c1
Sequence:CCGGCCAGTCTAGGATGACAAGGTACTCGAGTACCTTGTCATCCTAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031373.2-610s21c1
Sequence:CCGGGCCACAACAATCTGCGTATTACTCGAGTAATACGCAGATTGTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-1973s1c1
Sequence:CCGGGCTCTGTTGTTGGCTCTTCTTCTCGAGAAGAAGAGCCAACAACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-158s1c1
Sequence:CCGGCCAGTCTAGGATGACAAGGTACTCGAGTACCTTGTCATCCTAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-610s1c1
Sequence:CCGGGCCACAACAATCTGCGTATTACTCGAGTAATACGCAGATTGTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-206s1c1
Sequence:CCGGGCAAAGATACCGGCACAACTACTCGAGTAGTTGTGCCGGTATCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-609s1c1
Sequence:CCGGAGCCACAACAATCTGCGTATTCTCGAGAATACGCAGATTGTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031373
VALIDATED
OGFR MISSION shRNA Lentiviral Transduction Particles
opioid growth factor receptor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031373.2-206s21c1
Sequence:CCGGGCAAAGATACCGGCACAACTACTCGAGTAGTTGTGCCGGTATCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031373.2-1973s21c1
Sequence:CCGGGCTCTGTTGTTGGCTCTTCTTCTCGAGAAGAAGAGCCAACAACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031373.2-1270s21c1
Sequence:CCGGTTGTGGCTAGGGTGGCTAATGCTCGAGCATTAGCCACCCTAGCCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031373.2-158s21c1
Sequence:CCGGCCAGTCTAGGATGACAAGGTACTCGAGTACCTTGTCATCCTAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031373.2-610s21c1
Sequence:CCGGGCCACAACAATCTGCGTATTACTCGAGTAATACGCAGATTGTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-1973s1c1
Sequence:CCGGGCTCTGTTGTTGGCTCTTCTTCTCGAGAAGAAGAGCCAACAACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-158s1c1
Sequence:CCGGCCAGTCTAGGATGACAAGGTACTCGAGTACCTTGTCATCCTAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-610s1c1
Sequence:CCGGGCCACAACAATCTGCGTATTACTCGAGTAATACGCAGATTGTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-206s1c1
Sequence:CCGGGCAAAGATACCGGCACAACTACTCGAGTAGTTGTGCCGGTATCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031373.2-609s1c1
Sequence:CCGGAGCCACAACAATCTGCGTATTCTCGAGAATACGCAGATTGTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)