EMAIL THIS PAGE TO A FRIEND

OGFRL1

opioid growth factor receptor-like 1

83 Gene Product Result for
Synonyms: dJ331H24.1
UniProtKB ID: Q5TC84, Q2TAC1, Q8NEQ4, Q9H7B5
Gene ID:
Mouse(70155) opioid growth factor receptor-like 1
Rat(316290) opioid growth factor receptor-like 1
Zebrafish(559942) opioid growth factor receptor-like 1
cow(519626) opioid growth factor receptor-like 1
Horse(100071083) opioid growth factor receptor-like 1
chicken(421869) opioid growth factor receptor-like 1
dog(481876) opioid growth factor receptor-like 1
domestic guinea pig(100722305) opioid growth factor receptor-like 1
naked mole-rat(101706957) opioid growth factor receptor-like 1
sheep(101101996) opioid growth factor receptor-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024576 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024576 Rosetta Predictions human pricing
NM_001025708 Rosetta Predictions rat pricing
NM_001081079 Rosetta Predictions mouse pricing
XM_129809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177359 predicted 625
2 SASI_Hs01_00177360 predicted 1168
3 SASI_Hs01_00177361 predicted 862
4 SASI_Hs01_00177362 predicted 568
5 SASI_Hs01_00177363 predicted 1386
6 SASI_Hs01_00177364 predicted 962
7 SASI_Hs01_00177365 predicted 1063
8 SASI_Hs01_00177366 predicted 959
9 SASI_Hs01_00177367 predicted 569
10 SASI_Hs01_00177368 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101264 predicted 526
2 SASI_Rn02_00203329 predicted 644
3 SASI_Rn01_00101265 predicted 498
4 SASI_Rn01_00101266 predicted 791
5 SASI_Rn02_00203330 predicted 424
6 SASI_Rn01_00101268 predicted 1341
7 SASI_Rn01_00101269 predicted 785
8 SASI_Rn01_00101270 predicted 605
9 SASI_Rn01_00101271 predicted 391
10 SASI_Rn01_00101272 predicted 922
11 SASI_Rn01_00101263 predicted 1026
12 SASI_Rn01_00101267 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294971 predicted 825
2 SASI_Mm02_00294972 predicted 702
3 SASI_Mm02_00294973 predicted 1025
4 SASI_Mm02_00294974 predicted 785
5 SASI_Mm02_00294975 predicted 435
6 SASI_Mm02_00294976 predicted 929
7 SASI_Mm02_00294977 predicted 796
8 SASI_Mm02_00294978 predicted 656
9 SASI_Mm02_00294979 predicted 398
10 SASI_Mm02_00294980 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215197 predicted 924
2 SASI_Mm01_00215198 predicted 1035
3 SASI_Mm01_00215199 predicted 1018
4 SASI_Mm01_00215200 predicted 938
5 SASI_Mm01_00215201 predicted 957
6 SASI_Mm01_00215202 predicted 1190
7 SASI_Mm01_00215203 predicted 959
8 SASI_Mm01_00215204 predicted 1286
9 SASI_Mm01_00215205 predicted 1186
10 SASI_Mm01_00215206 predicted 1007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024576
VALIDATED
OGFRL1 MISSION shRNA Bacterial Glycerol Stock
opioid growth factor receptor-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024576.3-1437s21c1
Sequence:CCGGATAACGAAGAAGGTGGAAATGCTCGAGCATTTCCACCTTCTTCGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024576.3-990s21c1
Sequence:CCGGAGCAGAGTGCTCTAGAGTATTCTCGAGAATACTCTAGAGCACTCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-1127s1c1
Sequence:CCGGGCCTCCAGTCATAACAGTCAACTCGAGTTGACTGTTATGACTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-826s1c1
Sequence:CCGGCCAGCACAACTATTTAAGAATCTCGAGATTCTTAAATAGTTGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-1356s1c1
Sequence:CCGGCAGTTACTACTCCCACAGAAACTCGAGTTTCTGTGGGAGTAGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-647s1c1
Sequence:CCGGGCCAAAGAACTAACTACATATCTCGAGATATGTAGTTAGTTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-926s1c1
Sequence:CCGGGCTCTTGTGGAGAATACTATTCTCGAGAATAGTATTCTCCACAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024576.3-1587s21c1
Sequence:CCGGGAACAGAGATGAGGTCAATTTCTCGAGAAATTGACCTCATCTCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024576.3-1564s21c1
Sequence:CCGGACTACTGTATCATTTATCCTACTCGAGTAGGATAAATGATACAGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024576
VALIDATED
OGFRL1 MISSION shRNA shRNA Plasmid DNA
opioid growth factor receptor-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024576.3-1437s21c1
Sequence:CCGGATAACGAAGAAGGTGGAAATGCTCGAGCATTTCCACCTTCTTCGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024576.3-990s21c1
Sequence:CCGGAGCAGAGTGCTCTAGAGTATTCTCGAGAATACTCTAGAGCACTCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-1127s1c1
Sequence:CCGGGCCTCCAGTCATAACAGTCAACTCGAGTTGACTGTTATGACTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-826s1c1
Sequence:CCGGCCAGCACAACTATTTAAGAATCTCGAGATTCTTAAATAGTTGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-1356s1c1
Sequence:CCGGCAGTTACTACTCCCACAGAAACTCGAGTTTCTGTGGGAGTAGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-647s1c1
Sequence:CCGGGCCAAAGAACTAACTACATATCTCGAGATATGTAGTTAGTTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-926s1c1
Sequence:CCGGGCTCTTGTGGAGAATACTATTCTCGAGAATAGTATTCTCCACAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024576.3-1587s21c1
Sequence:CCGGGAACAGAGATGAGGTCAATTTCTCGAGAAATTGACCTCATCTCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024576.3-1564s21c1
Sequence:CCGGACTACTGTATCATTTATCCTACTCGAGTAGGATAAATGATACAGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024576
VALIDATED
OGFRL1 MISSION shRNA Lentiviral Transduction Particles
opioid growth factor receptor-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024576.3-1437s21c1
Sequence:CCGGATAACGAAGAAGGTGGAAATGCTCGAGCATTTCCACCTTCTTCGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024576.3-990s21c1
Sequence:CCGGAGCAGAGTGCTCTAGAGTATTCTCGAGAATACTCTAGAGCACTCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-1127s1c1
Sequence:CCGGGCCTCCAGTCATAACAGTCAACTCGAGTTGACTGTTATGACTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-826s1c1
Sequence:CCGGCCAGCACAACTATTTAAGAATCTCGAGATTCTTAAATAGTTGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-1356s1c1
Sequence:CCGGCAGTTACTACTCCCACAGAAACTCGAGTTTCTGTGGGAGTAGTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-647s1c1
Sequence:CCGGGCCAAAGAACTAACTACATATCTCGAGATATGTAGTTAGTTCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024576.2-926s1c1
Sequence:CCGGGCTCTTGTGGAGAATACTATTCTCGAGAATAGTATTCTCCACAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024576.3-1587s21c1
Sequence:CCGGGAACAGAGATGAGGTCAATTTCTCGAGAAATTGACCTCATCTCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024576.3-1564s21c1
Sequence:CCGGACTACTGTATCATTTATCCTACTCGAGTAGGATAAATGATACAGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081079
VALIDATED
OGFRL1 MISSION shRNA Bacterial Glycerol Stock
opioid growth factor receptor-like 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-957s21c1
Sequence:CCGGAGAGTGCTCTGGAGTACTTTGCTCGAGCAAAGTACTCCAGAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-1185s21c1
Sequence:CCGGCAGGAGCTAGTCACGTAAATACTCGAGTATTTACGTGACTAGCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-704s21c1
Sequence:CCGGAGATTCCTCTTGGCTTATAAACTCGAGTTTATAAGCCAAGAGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-742s21c1
Sequence:CCGGTGGAATAAAGCTGATTGATAACTCGAGTTATCAATCAGCTTTATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081079
VALIDATED
OGFRL1 MISSION shRNA shRNA Plasmid DNA
opioid growth factor receptor-like 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-957s21c1
Sequence:CCGGAGAGTGCTCTGGAGTACTTTGCTCGAGCAAAGTACTCCAGAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-1185s21c1
Sequence:CCGGCAGGAGCTAGTCACGTAAATACTCGAGTATTTACGTGACTAGCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-704s21c1
Sequence:CCGGAGATTCCTCTTGGCTTATAAACTCGAGTTTATAAGCCAAGAGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-742s21c1
Sequence:CCGGTGGAATAAAGCTGATTGATAACTCGAGTTATCAATCAGCTTTATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081079
VALIDATED
OGFRL1 MISSION shRNA Lentiviral Transduction Particles
opioid growth factor receptor-like 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-957s21c1
Sequence:CCGGAGAGTGCTCTGGAGTACTTTGCTCGAGCAAAGTACTCCAGAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-1185s21c1
Sequence:CCGGCAGGAGCTAGTCACGTAAATACTCGAGTATTTACGTGACTAGCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-704s21c1
Sequence:CCGGAGATTCCTCTTGGCTTATAAACTCGAGTTTATAAGCCAAGAGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081079.1-742s21c1
Sequence:CCGGTGGAATAAAGCTGATTGATAACTCGAGTTATCAATCAGCTTTATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)