EMAIL THIS PAGE TO A FRIEND

OGN

osteoglycin

76 Gene Product Result for
Synonyms: OG OIF SLRR3A
UniProtKB ID: P20774, Q6FIB0, Q9UF90, Q9UNK5
Gene ID:
Human(4969) Summary: This gene encodes a protein which induces ectopic bone formation in conjunction with transforming growth factor beta. This protein is a small proteoglycan which contains tandem leucine-rich repeats (LRR). Alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18295) osteoglycin
Rat(291015) osteoglycin
Goat(100860756) osteoglycin
sheep(101108451) osteoglycin
Zebrafish(541445) osteoglycin
chicken(374039) osteoglycin
cow(280884) osteoglycin
dog(610704) osteoglycin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014057 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016721 MISSION® esiRNA esiRNA targeting human OGN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014057 Rosetta Predictions human pricing
NM_024416 Rosetta Predictions human pricing
NM_033014 Rosetta Predictions human pricing
NM_001106103 Rosetta Predictions rat pricing
NM_008760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021530 predicted 963
2 SASI_Hs01_00021533 predicted 1034
3 SASI_Hs01_00021531 predicted 412
4 SASI_Hs01_00021534 predicted 474
5 SASI_Hs02_00345071 predicted 967
6 SASI_Hs01_00021535 predicted 654
7 SASI_Hs01_00021536 predicted 1191
8 SASI_Hs01_00021538 predicted 836
9 SASI_Hs01_00021539 predicted 738
10 SASI_Hs02_00345072 predicted 932
11 SASI_Hs01_00021532 predicted 848
12 SASI_Hs01_00021537 predicted 149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056379 predicted 972
2 SASI_Hs01_00056380 predicted 420
3 SASI_Hs01_00056381 predicted 943
4 SASI_Hs01_00056382 predicted 1044
5 SASI_Hs01_00056383 predicted 485
6 SASI_Hs01_00056384 predicted 661
7 SASI_Hs01_00056385 predicted 1199
8 SASI_Hs01_00056386 predicted 246
9 SASI_Hs01_00056387 predicted 851
10 SASI_Hs01_00056388 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145373 predicted 1246
2 SASI_Hs01_00145376 predicted 1315
3 SASI_Hs01_00145374 predicted 698
4 SASI_Hs01_00145377 predicted 750
5 SASI_Hs01_00145378 predicted 934
6 SASI_Hs02_00360684 predicted 1472
7 SASI_Hs01_00145381 predicted 1121
8 SASI_Hs01_00145382 predicted 1020
9 SASI_Hs02_00360685 predicted 971
10 SASI_Hs02_00360686 predicted 1213
11 SASI_Hs01_00145375 predicted 1132
12 SASI_Hs01_00145379 predicted 1381
13 SASI_Hs01_00145380 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215652 predicted 1143
2 SASI_Rn02_00215653 predicted 873
3 SASI_Rn02_00215654 predicted 283
4 SASI_Rn02_00215655 predicted 246
5 SASI_Rn02_00215656 predicted 1087
6 SASI_Rn02_00215657 predicted 841
7 SASI_Rn02_00215658 predicted 529
8 SASI_Rn02_00215659 predicted 631
9 SASI_Rn02_00215660 predicted 816
10 SASI_Rn02_00215661 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105762 predicted 449
2 SASI_Mm02_00314650 predicted 310
3 SASI_Mm01_00105763 predicted 833
4 SASI_Mm01_00105764 predicted 400
5 SASI_Mm01_00105765 predicted 482
6 SASI_Mm01_00105766 predicted 1030
7 SASI_Mm01_00105767 predicted 729
8 SASI_Mm01_00105768 predicted 862
9 SASI_Mm01_00105769 predicted 794
10 SASI_Mm01_00105770 predicted 925
11 SASI_Mm01_00105771 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014057
OGN MISSION shRNA Bacterial Glycerol Stock
osteoglycin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-567s1c1
Sequence:CCGGCCTAACTTAAGAAGACTCGATCTCGAGATCGAGTCTTCTTAAGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-837s1c1
Sequence:CCGGCCAGAAAGTCTACGTGTAATTCTCGAGAATTACACGTAGACTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-493s1c1
Sequence:CCGGCAAAGGAATCAGCCTATCTTTCTCGAGAAAGATAGGCTGATTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014057.2-1319s1c1
Sequence:CCGGGCCCAAATTTGAGATGCATTACTCGAGTAATGCATCTCAAATTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-879s1c1
Sequence:CCGGGCTTCAATTACAGATGACACACTCGAGTGTGTCATCTGTAATTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014057.3-1447s21c1
Sequence:CCGGTGATGTAAGTACGAGGATAAACTCGAGTTTATCCTCGTACTTACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014057.3-1132s21c1
Sequence:CCGGACCTCTATTGGTACAACATATCTCGAGATATGTTGTACCAATAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014057.3-910s21c1
Sequence:CCGGGGAATCCGTGCCTCTTAATTTCTCGAGAAATTAAGAGGCACGGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014057
OGN MISSION shRNA shRNA Plasmid DNA
osteoglycin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-567s1c1
Sequence:CCGGCCTAACTTAAGAAGACTCGATCTCGAGATCGAGTCTTCTTAAGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-837s1c1
Sequence:CCGGCCAGAAAGTCTACGTGTAATTCTCGAGAATTACACGTAGACTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-493s1c1
Sequence:CCGGCAAAGGAATCAGCCTATCTTTCTCGAGAAAGATAGGCTGATTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014057.2-1319s1c1
Sequence:CCGGGCCCAAATTTGAGATGCATTACTCGAGTAATGCATCTCAAATTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-879s1c1
Sequence:CCGGGCTTCAATTACAGATGACACACTCGAGTGTGTCATCTGTAATTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014057.3-1447s21c1
Sequence:CCGGTGATGTAAGTACGAGGATAAACTCGAGTTTATCCTCGTACTTACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014057.3-1132s21c1
Sequence:CCGGACCTCTATTGGTACAACATATCTCGAGATATGTTGTACCAATAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014057.3-910s21c1
Sequence:CCGGGGAATCCGTGCCTCTTAATTTCTCGAGAAATTAAGAGGCACGGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014057
OGN MISSION shRNA Lentiviral Transduction Particles
osteoglycin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-567s1c1
Sequence:CCGGCCTAACTTAAGAAGACTCGATCTCGAGATCGAGTCTTCTTAAGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-837s1c1
Sequence:CCGGCCAGAAAGTCTACGTGTAATTCTCGAGAATTACACGTAGACTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-493s1c1
Sequence:CCGGCAAAGGAATCAGCCTATCTTTCTCGAGAAAGATAGGCTGATTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014057.2-1319s1c1
Sequence:CCGGGCCCAAATTTGAGATGCATTACTCGAGTAATGCATCTCAAATTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014057.2-879s1c1
Sequence:CCGGGCTTCAATTACAGATGACACACTCGAGTGTGTCATCTGTAATTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014057.3-1447s21c1
Sequence:CCGGTGATGTAAGTACGAGGATAAACTCGAGTTTATCCTCGTACTTACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014057.3-1132s21c1
Sequence:CCGGACCTCTATTGGTACAACATATCTCGAGATATGTTGTACCAATAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014057.3-910s21c1
Sequence:CCGGGGAATCCGTGCCTCTTAATTTCTCGAGAAATTAAGAGGCACGGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008760
VALIDATED
OGN MISSION shRNA Bacterial Glycerol Stock
osteoglycin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008760.2-917s1c1
Sequence:CCGGCGGGAGCGAATTGAAGAGATTCTCGAGAATCTCTTCAATTCGCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008760.2-691s1c1
Sequence:CCGGGCTTACTTTACTTAATGCCAACTCGAGTTGGCATTAAGTAAAGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008760.2-2246s1c1
Sequence:CCGGGCCACAACTATTGCTCTAATACTCGAGTATTAGAGCAATAGTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008760.2-880s1c1
Sequence:CCGGTGATACATTCTGCAAGGCTAACTCGAGTTAGCCTTGCAGAATGTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008760.2-836s1c1
Sequence:CCGGCGTGTAATTCACCTTCAGTTTCTCGAGAAACTGAAGGTGAATTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-352s21c1
Sequence:CCGGGATGAAGTTATACCATCATTACTCGAGTAATGATGGTATAACTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008760.4-2245s21c1
Sequence:CCGGGCCACAACTATTGCTCTAATACTCGAGTATTAGAGCAATAGTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-835s21c1
Sequence:CCGGCGTGTAATTCACCTTCAGTTTCTCGAGAAACTGAAGGTGAATTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-896s21c1
Sequence:CCGGCTAATGACACTCGTTACATTCCTCGAGGAATGTAACGAGTGTCATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-868s21c1
Sequence:CCGGTCACTTACAGATGATACATTCCTCGAGGAATGTATCATCTGTAAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008760
VALIDATED
OGN MISSION shRNA shRNA Plasmid DNA
osteoglycin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008760.2-917s1c1
Sequence:CCGGCGGGAGCGAATTGAAGAGATTCTCGAGAATCTCTTCAATTCGCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008760.2-691s1c1
Sequence:CCGGGCTTACTTTACTTAATGCCAACTCGAGTTGGCATTAAGTAAAGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008760.2-2246s1c1
Sequence:CCGGGCCACAACTATTGCTCTAATACTCGAGTATTAGAGCAATAGTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008760.2-880s1c1
Sequence:CCGGTGATACATTCTGCAAGGCTAACTCGAGTTAGCCTTGCAGAATGTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008760.2-836s1c1
Sequence:CCGGCGTGTAATTCACCTTCAGTTTCTCGAGAAACTGAAGGTGAATTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-352s21c1
Sequence:CCGGGATGAAGTTATACCATCATTACTCGAGTAATGATGGTATAACTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008760.4-2245s21c1
Sequence:CCGGGCCACAACTATTGCTCTAATACTCGAGTATTAGAGCAATAGTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-835s21c1
Sequence:CCGGCGTGTAATTCACCTTCAGTTTCTCGAGAAACTGAAGGTGAATTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-896s21c1
Sequence:CCGGCTAATGACACTCGTTACATTCCTCGAGGAATGTAACGAGTGTCATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-868s21c1
Sequence:CCGGTCACTTACAGATGATACATTCCTCGAGGAATGTATCATCTGTAAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008760
VALIDATED
OGN MISSION shRNA Lentiviral Transduction Particles
osteoglycin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008760.2-917s1c1
Sequence:CCGGCGGGAGCGAATTGAAGAGATTCTCGAGAATCTCTTCAATTCGCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008760.2-691s1c1
Sequence:CCGGGCTTACTTTACTTAATGCCAACTCGAGTTGGCATTAAGTAAAGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008760.2-2246s1c1
Sequence:CCGGGCCACAACTATTGCTCTAATACTCGAGTATTAGAGCAATAGTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008760.2-880s1c1
Sequence:CCGGTGATACATTCTGCAAGGCTAACTCGAGTTAGCCTTGCAGAATGTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008760.2-836s1c1
Sequence:CCGGCGTGTAATTCACCTTCAGTTTCTCGAGAAACTGAAGGTGAATTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-352s21c1
Sequence:CCGGGATGAAGTTATACCATCATTACTCGAGTAATGATGGTATAACTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008760.4-2245s21c1
Sequence:CCGGGCCACAACTATTGCTCTAATACTCGAGTATTAGAGCAATAGTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-835s21c1
Sequence:CCGGCGTGTAATTCACCTTCAGTTTCTCGAGAAACTGAAGGTGAATTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-896s21c1
Sequence:CCGGCTAATGACACTCGTTACATTCCTCGAGGAATGTAACGAGTGTCATTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008760.4-868s21c1
Sequence:CCGGTCACTTACAGATGATACATTCCTCGAGGAATGTATCATCTGTAAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)