EMAIL THIS PAGE TO A FRIEND

OGT

O-linked N-acetylglucosamine (GlcNAc) transferase

204 Gene Product Result for
Synonyms: HRNT1 O-GLCNAC
UniProtKB ID: O15294, Q7Z3K0, Q8WWM8, Q96CC1, Q9UG57
Gene ID:
Human(8473) Summary: This gene encodes a glycosyltransferase that catalyzes the addition of a single N-acetylglucosamine in O-glycosidic linkage to serine or threonine residues. Since both phosphorylation and glycosylation compete for similar serine or threonine residues, the two processes may compete for sites, or they may alter the substrate specificity of nearby sites by steric or electrostatic effects. The protein contains multiple tetratricopeptide repeats that are required for optimal recognition of substrates. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(108155) O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)
Rat(26295) O-linked N-acetylglucosamine (GlcNAc) transferase
chicken(422203) O-linked N-acetylglucosamine (GlcNAc) transferase
dog(480955) O-linked N-acetylglucosamine (GlcNAc) transferase
domestic cat(101094162) O-linked N-acetylglucosamine (GlcNAc) transferase
cow(532053) O-linked N-acetylglucosamine (GlcNAc) transferase
Horse(100056148) O-linked N-acetylglucosamine (GlcNAc) transferase
sheep(101106996) O-linked N-acetylglucosamine (GlcNAc) transferase
Domestic Rabbit(100354727) O-linked N-acetylglucosamine (GlcNAc) transferase
domestic guinea pig(100728617) O-linked N-acetylglucosamine (GlcNAc) transferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
O6264 Anti-O-GlcNAc Transferase (DM-17) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunoprecipitation (IP), microarray, western blot pricing
O6139 Anti-O-GlcNAc Transferase (SQ-17) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunoprecipitation (IP), western blot pricing
O6014 Anti-O-GlcNAc Transferase (TI-14) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human, mouse
immunofluorescence, western blot pricing
SAB2108697 Anti-OGT affinity isolated antibody horse, rat, rabbit, canine, pig, mouse, bovine, zebrafish, guinea pig, mouse
immunohistochemistry, western blot pricing
SAB2500715 Anti-OGT antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB2101676 Anti-OGT antibody produced in rabbit affinity isolated antibody horse, mouse, human, zebrafish, guinea pig, rat, pig, bovine, rabbit, canine
western blot pricing
HPA030751 Anti-OGT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 mouse, rat, human
immunohistochemistry, western blot pricing
HPA030752 Anti-OGT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry, western blot pricing
HPA030754 Anti-OGT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA030753 Anti-OGT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
O7764 Monoclonal Anti-β-O-Linked N-Acetylglucosamine antibody produced in mouse clone CTD110.6, purified from hybridoma cell culture wide range
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB2702272 Monoclonal Anti-O-GlcNAc transferase antibody produced in mouse clone GT678, affinity isolated antibody human, rat, mouse
immunofluorescence, western blot pricing
SAB2702273 Monoclonal Anti-O-GlcNAc transferase antibody produced in mouse clone GT2037, affinity isolated antibody human, mouse, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181672 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181672 Rosetta Predictions human pricing
NM_181673 Rosetta Predictions human pricing
NM_017107 Rosetta Predictions rat pricing
NM_139144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141131 predicted 2434
2 SASI_Hs01_00141132 predicted 754
3 SASI_Hs01_00141134 predicted 670
4 SASI_Hs01_00141135 predicted 3409
5 SASI_Hs01_00141136 predicted 1510
6 SASI_Hs02_00370265 predicted 2712
7 SASI_Hs01_00141138 predicted 1650
8 SASI_Hs01_00141139 predicted 1386
9 SASI_Hs01_00141140 predicted 875
10 SASI_Hs02_00370266 predicted 1565
11 SASI_Hs01_00141133 predicted 1309
12 SASI_Hs01_00141137 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172243 predicted 2406
2 SASI_Hs01_00172244 predicted 726
3 SASI_Hs01_00172246 predicted 644
4 SASI_Hs01_00172247 predicted 3380
5 SASI_Hs01_00172248 predicted 1482
6 SASI_Hs02_00370267 predicted 2682
7 SASI_Hs01_00172250 predicted 1617
8 SASI_Hs01_00172251 predicted 1357
9 SASI_Hs01_00172252 predicted 843
10 SASI_Hs02_00370268 predicted 1527
11 SASI_Hs01_00172245 predicted 1277
12 SASI_Hs01_00172249 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057968 predicted 2513
2 SASI_Rn01_00057969 predicted 1509
3 SASI_Rn01_00057971 predicted 1665
4 SASI_Rn01_00057972 predicted 2401
5 SASI_Rn01_00057974 predicted 1833
6 SASI_Rn02_00261340 predicted 299
7 SASI_Rn01_00057975 predicted 410
8 SASI_Rn01_00057976 predicted 2387
9 SASI_Rn01_00057977 predicted 1523
10 SASI_Rn02_00261341 predicted 3290
11 SASI_Rn01_00057970 predicted 1747
12 SASI_Rn01_00057973 predicted 3325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062735 predicted 2115
2 SASI_Mm01_00062736 predicted 1375
3 SASI_Mm02_00339891 predicted 3157
4 SASI_Mm01_00062737 predicted 287
5 SASI_Mm01_00062740 predicted 3255
6 SASI_Mm01_00062741 predicted 1653
7 SASI_Mm01_00062742 predicted 1965
8 SASI_Mm01_00062743 predicted 1559
9 SASI_Mm02_00339892 predicted 1924
10 SASI_Mm01_00062744 predicted 2636
11 SASI_Mm01_00062738 predicted 1810
12 SASI_Mm01_00062739 predicted 2527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139144
VALIDATED
OGT MISSION shRNA Bacterial Glycerol Stock
O-linked N-acetylglucosamine (GlcNAc) transferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139144.2-2533s21c1
Sequence:CCGGGCTCTTAATATGCCCGTTATTCTCGAGAATAACGGGCATATTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139144.2-3235s21c1
Sequence:CCGGCCTCTGTTCAACACCAAACAACTCGAGTTGTTTGGTGTTGAACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139144.2-4321s21c1
Sequence:CCGGCCCATTTCTTTCAGCAGAAATCTCGAGATTTCTGCTGAAAGAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139144.2-958s21c1
Sequence:CCGGGCAGCTTATCTTCGTGCCTTACTCGAGTAAGGCACGAAGATAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139144.2-1028s21c1
Sequence:CCGGACTACGAGCAAGGCCTAATAGCTCGAGCTATTAGGCCTTGCTCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139144.2-2533s1c1
Sequence:CCGGGCTCTTAATATGCCCGTTATTCTCGAGAATAACGGGCATATTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139144.2-958s1c1
Sequence:CCGGGCAGCTTATCTTCGTGCCTTACTCGAGTAAGGCACGAAGATAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139144.2-1467s1c1
Sequence:CCGGGCAGTGTTATACTCGTGCCATCTCGAGATGGCACGAGTATAACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139144.2-4321s1c1
Sequence:CCGGCCCATTTCTTTCAGCAGAAATCTCGAGATTTCTGCTGAAAGAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139144.2-3235s1c1
Sequence:CCGGCCTCTGTTCAACACCAAACAACTCGAGTTGTTTGGTGTTGAACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139144
VALIDATED
OGT MISSION shRNA shRNA Plasmid DNA
O-linked N-acetylglucosamine (GlcNAc) transferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139144.2-2533s21c1
Sequence:CCGGGCTCTTAATATGCCCGTTATTCTCGAGAATAACGGGCATATTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139144.2-3235s21c1
Sequence:CCGGCCTCTGTTCAACACCAAACAACTCGAGTTGTTTGGTGTTGAACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139144.2-4321s21c1
Sequence:CCGGCCCATTTCTTTCAGCAGAAATCTCGAGATTTCTGCTGAAAGAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139144.2-958s21c1
Sequence:CCGGGCAGCTTATCTTCGTGCCTTACTCGAGTAAGGCACGAAGATAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139144.2-1028s21c1
Sequence:CCGGACTACGAGCAAGGCCTAATAGCTCGAGCTATTAGGCCTTGCTCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139144.2-2533s1c1
Sequence:CCGGGCTCTTAATATGCCCGTTATTCTCGAGAATAACGGGCATATTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139144.2-958s1c1
Sequence:CCGGGCAGCTTATCTTCGTGCCTTACTCGAGTAAGGCACGAAGATAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139144.2-1467s1c1
Sequence:CCGGGCAGTGTTATACTCGTGCCATCTCGAGATGGCACGAGTATAACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139144.2-4321s1c1
Sequence:CCGGCCCATTTCTTTCAGCAGAAATCTCGAGATTTCTGCTGAAAGAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139144.2-3235s1c1
Sequence:CCGGCCTCTGTTCAACACCAAACAACTCGAGTTGTTTGGTGTTGAACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139144
VALIDATED
OGT MISSION shRNA Lentiviral Transduction Particles
O-linked N-acetylglucosamine (GlcNAc) transferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139144.2-2533s21c1
Sequence:CCGGGCTCTTAATATGCCCGTTATTCTCGAGAATAACGGGCATATTAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139144.2-3235s21c1
Sequence:CCGGCCTCTGTTCAACACCAAACAACTCGAGTTGTTTGGTGTTGAACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139144.2-4321s21c1
Sequence:CCGGCCCATTTCTTTCAGCAGAAATCTCGAGATTTCTGCTGAAAGAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139144.2-958s21c1
Sequence:CCGGGCAGCTTATCTTCGTGCCTTACTCGAGTAAGGCACGAAGATAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139144.2-1028s21c1
Sequence:CCGGACTACGAGCAAGGCCTAATAGCTCGAGCTATTAGGCCTTGCTCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139144.2-2533s1c1
Sequence:CCGGGCTCTTAATATGCCCGTTATTCTCGAGAATAACGGGCATATTAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139144.2-958s1c1
Sequence:CCGGGCAGCTTATCTTCGTGCCTTACTCGAGTAAGGCACGAAGATAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139144.2-1467s1c1
Sequence:CCGGGCAGTGTTATACTCGTGCCATCTCGAGATGGCACGAGTATAACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139144.2-4321s1c1
Sequence:CCGGCCCATTTCTTTCAGCAGAAATCTCGAGATTTCTGCTGAAAGAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139144.2-3235s1c1
Sequence:CCGGCCTCTGTTCAACACCAAACAACTCGAGTTGTTTGGTGTTGAACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181672
VALIDATED
OGT MISSION shRNA Bacterial Glycerol Stock
O-linked N-acetylglucosamine (GlcNAc) transferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-881s21c1
Sequence:CCGGCCAAACTTTCTGGATGCTTATCTCGAGATAAGCATCCAGAAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-2282s21c1
Sequence:CCGGGCTGAGCAGTATTCCGAGAAACTCGAGTTTCTCGGAATACTGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-968s21c1
Sequence:CCGGGCCCTAAGTTTGAGTCCAAATCTCGAGATTTGGACTCAAACTTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-446s21c1
Sequence:CCGGTTTAGCACTCTGGCAATTAAACTCGAGTTTAATTGCCAGAGTGCTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-3458s21c1
Sequence:CCGGTGTTGCAGATGGGTGATATATCTCGAGATATATCACCCATCTGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_181672.1-968s1c1
Sequence:CCGGGCCCTAAGTTTGAGTCCAAATCTCGAGATTTGGACTCAAACTTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181672.1-2042s1c1
Sequence:CCGGGCCAATCATTTCATTGATCTTCTCGAGAAGATCAATGAAATGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181672.1-2694s1c1
Sequence:CCGGCCATTATTGTAACCACCCGTTCTCGAGAACGGGTGGTTACAATAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_181672.1-2282s1c1
Sequence:CCGGGCTGAGCAGTATTCCGAGAAACTCGAGTTTCTCGGAATACTGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181672
VALIDATED
OGT MISSION shRNA shRNA Plasmid DNA
O-linked N-acetylglucosamine (GlcNAc) transferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-881s21c1
Sequence:CCGGCCAAACTTTCTGGATGCTTATCTCGAGATAAGCATCCAGAAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-2282s21c1
Sequence:CCGGGCTGAGCAGTATTCCGAGAAACTCGAGTTTCTCGGAATACTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-968s21c1
Sequence:CCGGGCCCTAAGTTTGAGTCCAAATCTCGAGATTTGGACTCAAACTTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-446s21c1
Sequence:CCGGTTTAGCACTCTGGCAATTAAACTCGAGTTTAATTGCCAGAGTGCTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-3458s21c1
Sequence:CCGGTGTTGCAGATGGGTGATATATCTCGAGATATATCACCCATCTGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_181672.1-968s1c1
Sequence:CCGGGCCCTAAGTTTGAGTCCAAATCTCGAGATTTGGACTCAAACTTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181672.1-2042s1c1
Sequence:CCGGGCCAATCATTTCATTGATCTTCTCGAGAAGATCAATGAAATGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181672.1-2694s1c1
Sequence:CCGGCCATTATTGTAACCACCCGTTCTCGAGAACGGGTGGTTACAATAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_181672.1-2282s1c1
Sequence:CCGGGCTGAGCAGTATTCCGAGAAACTCGAGTTTCTCGGAATACTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181672
VALIDATED
OGT MISSION shRNA Lentiviral Transduction Particles
O-linked N-acetylglucosamine (GlcNAc) transferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-881s21c1
Sequence:CCGGCCAAACTTTCTGGATGCTTATCTCGAGATAAGCATCCAGAAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-2282s21c1
Sequence:CCGGGCTGAGCAGTATTCCGAGAAACTCGAGTTTCTCGGAATACTGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-968s21c1
Sequence:CCGGGCCCTAAGTTTGAGTCCAAATCTCGAGATTTGGACTCAAACTTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-446s21c1
Sequence:CCGGTTTAGCACTCTGGCAATTAAACTCGAGTTTAATTGCCAGAGTGCTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_181672.1-3458s21c1
Sequence:CCGGTGTTGCAGATGGGTGATATATCTCGAGATATATCACCCATCTGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_181672.1-968s1c1
Sequence:CCGGGCCCTAAGTTTGAGTCCAAATCTCGAGATTTGGACTCAAACTTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181672.1-2042s1c1
Sequence:CCGGGCCAATCATTTCATTGATCTTCTCGAGAAGATCAATGAAATGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181672.1-2694s1c1
Sequence:CCGGCCATTATTGTAACCACCCGTTCTCGAGAACGGGTGGTTACAATAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_181672.1-2282s1c1
Sequence:CCGGGCTGAGCAGTATTCCGAGAAACTCGAGTTTCTCGGAATACTGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)