EMAIL THIS PAGE TO A FRIEND

OIP5

Opa interacting protein 5

60 Gene Product Result for
Synonyms: 5730547N13Rik CT86 LINT-25 MIS18B MIS18beta hMIS18beta
UniProtKB ID: O43482, Q96BX7
Gene ID:
Mouse(70645) Opa interacting protein 5
Rat(499873) Opa interacting protein 5
Zebrafish(799087) opa interacting protein 5
domestic cat(101084630) Opa interacting protein 5
cow(511100) Opa interacting protein 5
dog(608635) Opa interacting protein 5
chicken(423212) Opa interacting protein 5
domestic guinea pig(100732042) Opa interacting protein 5
naked mole-rat(101724615) Opa interacting protein 5
sheep(101115374) Opa interacting protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007280 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001042653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001042653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001042653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007280 Rosetta Predictions human pricing
XM_001080849 Rosetta Predictions rat pricing
XM_575214 Rosetta Predictions rat pricing
NM_001042653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199026 predicted 423
2 SASI_Hs01_00199028 predicted 424
3 SASI_Hs01_00199029 predicted 865
4 SASI_Hs01_00199030 predicted 662
5 SASI_Hs01_00199031 predicted 805
6 SASI_Hs02_00343337 predicted 948
7 SASI_Hs02_00343338 predicted 421
8 SASI_Hs02_00343339 predicted 436
9 SASI_Hs01_00199035 predicted 769
10 SASI_Hs02_00343340 predicted 279
11 SASI_Hs01_00199027 predicted 959
12 SASI_Hs01_00199032 predicted 486
13 SASI_Hs01_00199033 predicted 949
14 SASI_Hs01_00199034 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369630 predicted 332
2 SASI_Rn02_00369631 predicted 352
3 SASI_Rn02_00369632 predicted 387
4 SASI_Rn02_00369633 predicted 203
5 SASI_Rn02_00369634 predicted 393
6 SASI_Rn02_00369635 predicted 391
7 SASI_Rn02_00369636 predicted 453
8 SASI_Rn02_00369637 predicted 198
9 SASI_Rn02_00369638 predicted 506
10 SASI_Rn02_00369639 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403297 predicted 334
2 SASI_Rn02_00403298 predicted 348
3 SASI_Rn02_00403299 predicted 339
4 SASI_Rn02_00403300 predicted 346
5 SASI_Rn02_00403301 predicted 353
6 SASI_Rn02_00403302 predicted 296
7 SASI_Rn02_00403303 predicted 295
8 SASI_Rn02_00403304 predicted 266
9 SASI_Rn02_00403305 predicted 535
10 SASI_Rn02_00403306 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290855 predicted 764
2 SASI_Mm02_00290856 predicted 747
3 SASI_Mm02_00290857 predicted 630
4 SASI_Mm02_00290858 predicted 766
5 SASI_Mm02_00290859 predicted 761
6 SASI_Mm02_00290860 predicted 456
7 SASI_Mm02_00290861 predicted 827
8 SASI_Mm02_00290862 predicted 745
9 SASI_Mm02_00290863 predicted 622
10 SASI_Mm02_00290864 predicted 777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007280
VALIDATED
OIP5 MISSION shRNA Bacterial Glycerol Stock
Opa interacting protein 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007280.1-487s1c1
Sequence:CCGGCCCGTTGGTTTCCATCTGTATCTCGAGATACAGATGGAAACCAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007280.1-1051s21c1
Sequence:CCGGCCATGTGTCCTCTGATCTAAACTCGAGTTTAGATCAGAGGACACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007280.1-672s1c1
Sequence:CCGGGCTAACGCACAATCGCTTAAACTCGAGTTTAAGCGATTGTGCGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007280.1-604s1c1
Sequence:CCGGGCATCAGAGATGGATATTCAACTCGAGTTGAATATCCATCTCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007280.1-1051s1c1
Sequence:CCGGCCATGTGTCCTCTGATCTAAACTCGAGTTTAGATCAGAGGACACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007280.1-383s1c1
Sequence:CCGGGAGTTACAAATAACGTCGTTTCTCGAGAAACGACGTTATTTGTAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007280.1-672s21c1
Sequence:CCGGGCTAACGCACAATCGCTTAAACTCGAGTTTAAGCGATTGTGCGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007280.1-604s21c1
Sequence:CCGGGCATCAGAGATGGATATTCAACTCGAGTTGAATATCCATCTCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007280.1-383s21c1
Sequence:CCGGGAGTTACAAATAACGTCGTTTCTCGAGAAACGACGTTATTTGTAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007280.1-487s21c1
Sequence:CCGGCCCGTTGGTTTCCATCTGTATCTCGAGATACAGATGGAAACCAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007280
VALIDATED
OIP5 MISSION shRNA shRNA Plasmid DNA
Opa interacting protein 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007280.1-487s1c1
Sequence:CCGGCCCGTTGGTTTCCATCTGTATCTCGAGATACAGATGGAAACCAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007280.1-1051s21c1
Sequence:CCGGCCATGTGTCCTCTGATCTAAACTCGAGTTTAGATCAGAGGACACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007280.1-672s1c1
Sequence:CCGGGCTAACGCACAATCGCTTAAACTCGAGTTTAAGCGATTGTGCGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007280.1-604s1c1
Sequence:CCGGGCATCAGAGATGGATATTCAACTCGAGTTGAATATCCATCTCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007280.1-1051s1c1
Sequence:CCGGCCATGTGTCCTCTGATCTAAACTCGAGTTTAGATCAGAGGACACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007280.1-383s1c1
Sequence:CCGGGAGTTACAAATAACGTCGTTTCTCGAGAAACGACGTTATTTGTAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007280.1-672s21c1
Sequence:CCGGGCTAACGCACAATCGCTTAAACTCGAGTTTAAGCGATTGTGCGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007280.1-604s21c1
Sequence:CCGGGCATCAGAGATGGATATTCAACTCGAGTTGAATATCCATCTCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007280.1-383s21c1
Sequence:CCGGGAGTTACAAATAACGTCGTTTCTCGAGAAACGACGTTATTTGTAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007280.1-487s21c1
Sequence:CCGGCCCGTTGGTTTCCATCTGTATCTCGAGATACAGATGGAAACCAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007280
VALIDATED
OIP5 MISSION shRNA Lentiviral Transduction Particles
Opa interacting protein 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007280.1-487s1c1
Sequence:CCGGCCCGTTGGTTTCCATCTGTATCTCGAGATACAGATGGAAACCAACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007280.1-1051s21c1
Sequence:CCGGCCATGTGTCCTCTGATCTAAACTCGAGTTTAGATCAGAGGACACATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007280.1-672s1c1
Sequence:CCGGGCTAACGCACAATCGCTTAAACTCGAGTTTAAGCGATTGTGCGTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007280.1-604s1c1
Sequence:CCGGGCATCAGAGATGGATATTCAACTCGAGTTGAATATCCATCTCTGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007280.1-1051s1c1
Sequence:CCGGCCATGTGTCCTCTGATCTAAACTCGAGTTTAGATCAGAGGACACATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_007280.1-383s1c1
Sequence:CCGGGAGTTACAAATAACGTCGTTTCTCGAGAAACGACGTTATTTGTAACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007280.1-672s21c1
Sequence:CCGGGCTAACGCACAATCGCTTAAACTCGAGTTTAAGCGATTGTGCGTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007280.1-604s21c1
Sequence:CCGGGCATCAGAGATGGATATTCAACTCGAGTTGAATATCCATCTCTGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007280.1-383s21c1
Sequence:CCGGGAGTTACAAATAACGTCGTTTCTCGAGAAACGACGTTATTTGTAACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007280.1-487s21c1
Sequence:CCGGCCCGTTGGTTTCCATCTGTATCTCGAGATACAGATGGAAACCAACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042653
VALIDATED
OIP5 MISSION shRNA Bacterial Glycerol Stock
Opa interacting protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-638s21c1
Sequence:CCGGGCTAATGCATACTCGTCTAAACTCGAGTTTAGACGAGTATGCATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-245s21c1
Sequence:CCGGGAGATGTGCCGTGTTTCATTGCTCGAGCAATGAAACACGGCACATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-452s21c1
Sequence:CCGGTCCTGTTGGTTTCCATTTATACTCGAGTATAAATGGAAACCAACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-808s21c1
Sequence:CCGGTTACTCCATAATGCCTATTTCCTCGAGGAAATAGGCATTATGGAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-766s21c1
Sequence:CCGGTGTAACATGTGACTCTATTACCTCGAGGTAATAGAGTCACATGTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042653
VALIDATED
OIP5 MISSION shRNA shRNA Plasmid DNA
Opa interacting protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-638s21c1
Sequence:CCGGGCTAATGCATACTCGTCTAAACTCGAGTTTAGACGAGTATGCATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-245s21c1
Sequence:CCGGGAGATGTGCCGTGTTTCATTGCTCGAGCAATGAAACACGGCACATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-452s21c1
Sequence:CCGGTCCTGTTGGTTTCCATTTATACTCGAGTATAAATGGAAACCAACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-808s21c1
Sequence:CCGGTTACTCCATAATGCCTATTTCCTCGAGGAAATAGGCATTATGGAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-766s21c1
Sequence:CCGGTGTAACATGTGACTCTATTACCTCGAGGTAATAGAGTCACATGTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042653
VALIDATED
OIP5 MISSION shRNA Lentiviral Transduction Particles
Opa interacting protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-638s21c1
Sequence:CCGGGCTAATGCATACTCGTCTAAACTCGAGTTTAGACGAGTATGCATTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-245s21c1
Sequence:CCGGGAGATGTGCCGTGTTTCATTGCTCGAGCAATGAAACACGGCACATCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-452s21c1
Sequence:CCGGTCCTGTTGGTTTCCATTTATACTCGAGTATAAATGGAAACCAACAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-808s21c1
Sequence:CCGGTTACTCCATAATGCCTATTTCCTCGAGGAAATAGGCATTATGGAGTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042653.1-766s21c1
Sequence:CCGGTGTAACATGTGACTCTATTACCTCGAGGTAATAGAGTCACATGTTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)