EMAIL THIS PAGE TO A FRIEND

OLA1

Obg-like ATPase 1

141 Gene Product Result for
Synonyms: DOC45 GBP45 GTBP9 GTPBP9
Gene ID:
Mouse(67059) Obg-like ATPase 1
Rat(296488) Obg-like ATPase 1
sheep(101110909) Obg-like ATPase 1
domestic guinea pig(100734863) Obg-like ATPase 1
naked mole-rat(101711723) Obg-like ATPase 1
Zebrafish(326864) Obg-like ATPase 1
chicken(424144) Obg-like ATPase 1
dog(478803) Obg-like ATPase 1
cow(509966) Obg-like ATPase 1
Horse(100053204) Obg-like ATPase 1
domestic cat(101095035) Obg-like ATPase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011708 Rosetta Predictions human pricing
NM_013341 Rosetta Predictions human pricing
NM_001033927 Rosetta Predictions rat pricing
NM_025942 Rosetta Predictions mouse pricing
NM_030091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085375 predicted 1758
2 SASI_Hs02_00306026 predicted 1758
3 SASI_Hs02_00306027 predicted 1723
4 SASI_Hs02_00306028 predicted 1652
5 SASI_Hs02_00306029 predicted 679
6 SASI_Hs02_00306030 predicted 706
7 SASI_Hs01_00085376 predicted 979
8 SASI_Hs01_00085378 predicted 568
9 SASI_Hs01_00085379 predicted 927
10 SASI_Hs01_00085380 predicted 988
11 SASI_Hs01_00085373 predicted 949
12 SASI_Hs01_00085374 predicted 1101
13 SASI_Hs01_00085377 predicted 947
14 SASI_Hs01_00085381 predicted 758
15 SASI_Hs01_00085382 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244685 predicted 592
2 SASI_Hs01_00244693 predicted 629
3 SASI_Hs02_00344653 predicted 600
4 SASI_Hs02_00344654 predicted 605
5 SASI_Hs02_00344655 predicted 778
6 SASI_Hs02_00344656 predicted 815
7 SASI_Hs01_00244686 predicted 1079
8 SASI_Hs01_00244687 predicted 1042
9 SASI_Hs01_00244688 predicted 663
10 SASI_Hs01_00244689 predicted 855
11 SASI_Hs01_00244684 predicted 1052
12 SASI_Hs01_00244690 predicted 827
13 SASI_Hs01_00244691 predicted 1157
14 SASI_Hs01_00244692 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116929 predicted 927
2 SASI_Rn01_00116930 predicted 543
3 SASI_Rn01_00116931 predicted 1058
4 SASI_Rn01_00116932 predicted 690
5 SASI_Rn01_00116933 predicted 626
6 SASI_Rn01_00116934 predicted 627
7 SASI_Rn01_00116935 predicted 864
8 SASI_Rn01_00116936 predicted 347
9 SASI_Rn01_00116937 predicted 293
10 SASI_Rn02_00203830 predicted 667
11 SASI_Rn01_00116938 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329327 predicted 786
2 SASI_Mm01_00075534 predicted 1155
3 SASI_Mm01_00075535 predicted 727
4 SASI_Mm01_00075536 predicted 718
5 SASI_Mm01_00075537 predicted 257
6 SASI_Mm01_00075538 predicted 834
7 SASI_Mm01_00075539 predicted 355
8 SASI_Mm02_00329328 predicted 1024
9 SASI_Mm01_00075540 predicted 567
10 SASI_Mm01_00075541 predicted 426
11 SASI_Mm01_00075533 predicted 406
12 SASI_Mm01_00075542 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161192 predicted 366
2 SASI_Mm01_00161194 predicted 638
3 SASI_Mm01_00161195 predicted 254
4 SASI_Mm01_00161196 predicted 582
5 SASI_Mm01_00161197 predicted 232
6 SASI_Mm01_00161198 predicted 356
7 SASI_Mm01_00161199 predicted 313
8 SASI_Mm02_00336488 predicted 208
9 SASI_Mm01_00161200 predicted 568
10 SASI_Mm01_00161201 predicted 430
11 SASI_Mm01_00161193 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013341
VALIDATED
OLA1 MISSION shRNA Bacterial Glycerol Stock
Obg-like ATPase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-800s1c1
Sequence:CCGGGCCTTGGAACTCAAGTTGCAACTCGAGTTGCAACTTGAGTTCCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013341.2-389s1c1
Sequence:CCGGGATGATGATATCACGCACGTTCTCGAGAACGTGCGTGATATCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-385s21c1
Sequence:CCGGCCAGATGAAAGGTTTGACTTTCTCGAGAAAGTCAAACCTTTCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-655s21c1
Sequence:CCGGGAGGAAATGATTGGGCCCATTCTCGAGAATGGGCCCAATCATTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013341.2-771s1c1
Sequence:CCGGCAGGTGCTTTGGTCATTCCTTCTCGAGAAGGAATGACCAAAGCACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-473s1c1
Sequence:CCGGGAGGAAATGATTGGGCCCATTCTCGAGAATGGGCCCAATCATTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-1094s1c1
Sequence:CCGGGCTGCTGGAAAGTACAGACAACTCGAGTTGTCTGTACTTTCCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-858s1c1
Sequence:CCGGCGAACATGACACAAAGTGCTTCTCGAGAAGCACTTTGTGTCATGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-605s1c1
Sequence:CCGGCGCTTCTATCATGATTGGAATCTCGAGATTCCAATCATGATAGAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-203s1c1
Sequence:CCGGCCAGATGAAAGGTTTGACTTTCTCGAGAAAGTCAAACCTTTCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013341.2-261s1c1
Sequence:CCGGCCTTTCTAAATGTGGTGGATACTCGAGTATCCACCACATTTAGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-982s21c1
Sequence:CCGGGCCTTGGAACTCAAGTTGCAACTCGAGTTGCAACTTGAGTTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-1040s21c1
Sequence:CCGGCGAACATGACACAAAGTGCTTCTCGAGAAGCACTTTGTGTCATGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-1276s21c1
Sequence:CCGGGCTGCTGGAAAGTACAGACAACTCGAGTTGTCTGTACTTTCCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013341
VALIDATED
OLA1 MISSION shRNA shRNA Plasmid DNA
Obg-like ATPase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-800s1c1
Sequence:CCGGGCCTTGGAACTCAAGTTGCAACTCGAGTTGCAACTTGAGTTCCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013341.2-389s1c1
Sequence:CCGGGATGATGATATCACGCACGTTCTCGAGAACGTGCGTGATATCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-385s21c1
Sequence:CCGGCCAGATGAAAGGTTTGACTTTCTCGAGAAAGTCAAACCTTTCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-655s21c1
Sequence:CCGGGAGGAAATGATTGGGCCCATTCTCGAGAATGGGCCCAATCATTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013341.2-771s1c1
Sequence:CCGGCAGGTGCTTTGGTCATTCCTTCTCGAGAAGGAATGACCAAAGCACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-473s1c1
Sequence:CCGGGAGGAAATGATTGGGCCCATTCTCGAGAATGGGCCCAATCATTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-1094s1c1
Sequence:CCGGGCTGCTGGAAAGTACAGACAACTCGAGTTGTCTGTACTTTCCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-858s1c1
Sequence:CCGGCGAACATGACACAAAGTGCTTCTCGAGAAGCACTTTGTGTCATGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-605s1c1
Sequence:CCGGCGCTTCTATCATGATTGGAATCTCGAGATTCCAATCATGATAGAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-203s1c1
Sequence:CCGGCCAGATGAAAGGTTTGACTTTCTCGAGAAAGTCAAACCTTTCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013341.2-261s1c1
Sequence:CCGGCCTTTCTAAATGTGGTGGATACTCGAGTATCCACCACATTTAGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-982s21c1
Sequence:CCGGGCCTTGGAACTCAAGTTGCAACTCGAGTTGCAACTTGAGTTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-1040s21c1
Sequence:CCGGCGAACATGACACAAAGTGCTTCTCGAGAAGCACTTTGTGTCATGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-1276s21c1
Sequence:CCGGGCTGCTGGAAAGTACAGACAACTCGAGTTGTCTGTACTTTCCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013341
VALIDATED
OLA1 MISSION shRNA Lentiviral Transduction Particles
Obg-like ATPase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-800s1c1
Sequence:CCGGGCCTTGGAACTCAAGTTGCAACTCGAGTTGCAACTTGAGTTCCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013341.2-389s1c1
Sequence:CCGGGATGATGATATCACGCACGTTCTCGAGAACGTGCGTGATATCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-385s21c1
Sequence:CCGGCCAGATGAAAGGTTTGACTTTCTCGAGAAAGTCAAACCTTTCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-655s21c1
Sequence:CCGGGAGGAAATGATTGGGCCCATTCTCGAGAATGGGCCCAATCATTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013341.2-771s1c1
Sequence:CCGGCAGGTGCTTTGGTCATTCCTTCTCGAGAAGGAATGACCAAAGCACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-473s1c1
Sequence:CCGGGAGGAAATGATTGGGCCCATTCTCGAGAATGGGCCCAATCATTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-1094s1c1
Sequence:CCGGGCTGCTGGAAAGTACAGACAACTCGAGTTGTCTGTACTTTCCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-858s1c1
Sequence:CCGGCGAACATGACACAAAGTGCTTCTCGAGAAGCACTTTGTGTCATGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-605s1c1
Sequence:CCGGCGCTTCTATCATGATTGGAATCTCGAGATTCCAATCATGATAGAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_013341.2-203s1c1
Sequence:CCGGCCAGATGAAAGGTTTGACTTTCTCGAGAAAGTCAAACCTTTCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013341.2-261s1c1
Sequence:CCGGCCTTTCTAAATGTGGTGGATACTCGAGTATCCACCACATTTAGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-982s21c1
Sequence:CCGGGCCTTGGAACTCAAGTTGCAACTCGAGTTGCAACTTGAGTTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-1040s21c1
Sequence:CCGGCGAACATGACACAAAGTGCTTCTCGAGAAGCACTTTGTGTCATGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013341.3-1276s21c1
Sequence:CCGGGCTGCTGGAAAGTACAGACAACTCGAGTTGTCTGTACTTTCCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025942
VALIDATED
OLA1 MISSION shRNA Bacterial Glycerol Stock
Obg-like ATPase 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025942.2-1017s21c1
Sequence:CCGGGAACATGACACAAAGTGCTTTCTCGAGAAAGCACTTTGTGTCATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025942.2-1527s21c1
Sequence:CCGGCCTTCAATGAAATGCAAGTTACTCGAGTAACTTGCATTTCATTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025942.1-707s1c1
Sequence:CCGGGAGTATGACATAATGTGCAAACTCGAGTTTGCACATTATGTCATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025942.1-1528s1c1
Sequence:CCGGCCTTCAATGAAATGCAAGTTACTCGAGTAACTTGCATTTCATTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025942.2-418s21c1
Sequence:CCGGGCTTTCCTAAATGTAGTGGATCTCGAGATCCACTACATTTAGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025942.1-1935s1c1
Sequence:CCGGCATGGGAATTAGAAGAAGAATCTCGAGATTCTTCTTCTAATTCCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025942.2-706s21c1
Sequence:CCGGGAGTATGACATAATGTGCAAACTCGAGTTTGCACATTATGTCATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025942.1-1196s1c1
Sequence:CCGGGCTGAAGTAATGAAGTATGAACTCGAGTTCATACTTCATTACTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025942.1-419s1c1
Sequence:CCGGGCTTTCCTAAATGTAGTGGATCTCGAGATCCACTACATTTAGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025942.1-1018s1c1
Sequence:CCGGGAACATGACACAAAGTGCTTTCTCGAGAAAGCACTTTGTGTCATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025942.2-833s1c1
Sequence:CCGGCAATGGTCTACTTGGTGAATCCTCGAGGATTCACCAAGTAGACCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025942.2-269s1c1
Sequence:CCGGCTACCTTCTTCAATGTATTAACTCGAGTTAATACATTGAAGAAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025942
VALIDATED
OLA1 MISSION shRNA shRNA Plasmid DNA
Obg-like ATPase 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025942.2-1017s21c1
Sequence:CCGGGAACATGACACAAAGTGCTTTCTCGAGAAAGCACTTTGTGTCATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025942.2-1527s21c1
Sequence:CCGGCCTTCAATGAAATGCAAGTTACTCGAGTAACTTGCATTTCATTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025942.1-707s1c1
Sequence:CCGGGAGTATGACATAATGTGCAAACTCGAGTTTGCACATTATGTCATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025942.1-1528s1c1
Sequence:CCGGCCTTCAATGAAATGCAAGTTACTCGAGTAACTTGCATTTCATTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025942.2-418s21c1
Sequence:CCGGGCTTTCCTAAATGTAGTGGATCTCGAGATCCACTACATTTAGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025942.1-1935s1c1
Sequence:CCGGCATGGGAATTAGAAGAAGAATCTCGAGATTCTTCTTCTAATTCCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025942.2-706s21c1
Sequence:CCGGGAGTATGACATAATGTGCAAACTCGAGTTTGCACATTATGTCATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025942.1-1196s1c1
Sequence:CCGGGCTGAAGTAATGAAGTATGAACTCGAGTTCATACTTCATTACTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025942.1-419s1c1
Sequence:CCGGGCTTTCCTAAATGTAGTGGATCTCGAGATCCACTACATTTAGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025942.1-1018s1c1
Sequence:CCGGGAACATGACACAAAGTGCTTTCTCGAGAAAGCACTTTGTGTCATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025942.2-833s1c1
Sequence:CCGGCAATGGTCTACTTGGTGAATCCTCGAGGATTCACCAAGTAGACCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025942.2-269s1c1
Sequence:CCGGCTACCTTCTTCAATGTATTAACTCGAGTTAATACATTGAAGAAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025942
VALIDATED
OLA1 MISSION shRNA Lentiviral Transduction Particles
Obg-like ATPase 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025942.2-1017s21c1
Sequence:CCGGGAACATGACACAAAGTGCTTTCTCGAGAAAGCACTTTGTGTCATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025942.2-1527s21c1
Sequence:CCGGCCTTCAATGAAATGCAAGTTACTCGAGTAACTTGCATTTCATTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025942.1-707s1c1
Sequence:CCGGGAGTATGACATAATGTGCAAACTCGAGTTTGCACATTATGTCATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025942.1-1528s1c1
Sequence:CCGGCCTTCAATGAAATGCAAGTTACTCGAGTAACTTGCATTTCATTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025942.2-418s21c1
Sequence:CCGGGCTTTCCTAAATGTAGTGGATCTCGAGATCCACTACATTTAGGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025942.1-1935s1c1
Sequence:CCGGCATGGGAATTAGAAGAAGAATCTCGAGATTCTTCTTCTAATTCCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025942.2-706s21c1
Sequence:CCGGGAGTATGACATAATGTGCAAACTCGAGTTTGCACATTATGTCATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025942.1-1196s1c1
Sequence:CCGGGCTGAAGTAATGAAGTATGAACTCGAGTTCATACTTCATTACTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025942.1-419s1c1
Sequence:CCGGGCTTTCCTAAATGTAGTGGATCTCGAGATCCACTACATTTAGGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025942.1-1018s1c1
Sequence:CCGGGAACATGACACAAAGTGCTTTCTCGAGAAAGCACTTTGTGTCATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025942.2-833s1c1
Sequence:CCGGCAATGGTCTACTTGGTGAATCCTCGAGGATTCACCAAGTAGACCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025942.2-269s1c1
Sequence:CCGGCTACCTTCTTCAATGTATTAACTCGAGTTAATACATTGAAGAAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)