EMAIL THIS PAGE TO A FRIEND

OLFM2

olfactomedin 2

46 Gene Product Result for
Synonyms: NOE2 NOELIN2 NOELIN2_V1 OlfC
UniProtKB ID: O95897, Q6IMJ3, Q96FC2
Gene ID:
Mouse(244723) olfactomedin 2
Rat(313783) olfactomedin 2
cow(507252) olfactomedin 2
domestic cat(101092245) olfactomedin 2
dog(484962) olfactomedin 2
naked mole-rat(101708988) olfactomedin 2
sheep(101114701) olfactomedin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_058164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058164 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155941 MISSION® esiRNA esiRNA human OLFM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058164 Rosetta Predictions human pricing
NM_001015017 Rosetta Predictions rat pricing
NM_173777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053740 predicted 1095
2 SASI_Hs01_00053741 predicted 261
3 SASI_Hs01_00053742 predicted 521
4 SASI_Hs01_00053743 predicted 1022
5 SASI_Hs01_00053744 predicted 982
6 SASI_Hs01_00053745 predicted 708
7 SASI_Hs01_00053746 predicted 771
8 SASI_Hs01_00053749 predicted 388
9 SASI_Hs02_00362066 predicted 278
10 SASI_Hs02_00362067 predicted 260
11 SASI_Hs01_00053747 predicted 949
12 SASI_Hs01_00053748 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202033 predicted 972
2 SASI_Rn02_00202034 predicted 1441
3 SASI_Rn02_00202035 predicted 1025
4 SASI_Rn02_00202036 predicted 282
5 SASI_Rn02_00202037 predicted 776
6 SASI_Rn02_00202038 predicted 1386
7 SASI_Rn02_00202039 predicted 454
8 SASI_Rn02_00202040 predicted 450
9 SASI_Rn02_00202041 predicted 729
10 SASI_Rn02_00202042 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101676 predicted 252
2 SASI_Mm01_00101677 predicted 1098
3 SASI_Mm01_00101678 predicted 784
4 SASI_Mm01_00101680 predicted 589
5 SASI_Mm01_00101681 predicted 1156
6 SASI_Mm01_00101682 predicted 537
7 SASI_Mm02_00345429 predicted 511
8 SASI_Mm01_00101683 predicted 1207
9 SASI_Mm01_00101684 predicted 268
10 SASI_Mm01_00101685 predicted 997
11 SASI_Mm01_00101679 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173777
OLFM2 MISSION shRNA Bacterial Glycerol Stock
olfactomedin 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173777.3-459s21c1
Sequence:CCGGAGCAGACACACGAACCATTGTCTCGAGACAATGGTTCGTGTGTCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173777.3-296s21c1
Sequence:CCGGCATTCCGGGATCTCCAGTATGCTCGAGCATACTGGAGATCCCGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173777.3-1209s21c1
Sequence:CCGGCAAGGTCTACTTTGCGTACTTCTCGAGAAGTACGCAAAGTAGACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173777.2-1531s1c1
Sequence:CCGGCCCAGCTTTCTGTTCTCAGTACTCGAGTACTGAGAACAGAAAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-654s1c1
Sequence:CCGGCGTCAGTAACCCTATTACCATCTCGAGATGGTAATAGGGTTACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-653s1c1
Sequence:CCGGGCGTCAGTAACCCTATTACCACTCGAGTGGTAATAGGGTTACTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-1276s1c1
Sequence:CCGGGTGCCCTTCAACAACCAGTATCTCGAGATACTGGTTGTTGAAGGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-1299s1c1
Sequence:CCGGGCACATCTCGATGCTGGATTACTCGAGTAATCCAGCATCGAGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173777
OLFM2 MISSION shRNA shRNA Plasmid DNA
olfactomedin 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173777.3-459s21c1
Sequence:CCGGAGCAGACACACGAACCATTGTCTCGAGACAATGGTTCGTGTGTCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173777.3-296s21c1
Sequence:CCGGCATTCCGGGATCTCCAGTATGCTCGAGCATACTGGAGATCCCGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173777.3-1209s21c1
Sequence:CCGGCAAGGTCTACTTTGCGTACTTCTCGAGAAGTACGCAAAGTAGACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173777.2-1531s1c1
Sequence:CCGGCCCAGCTTTCTGTTCTCAGTACTCGAGTACTGAGAACAGAAAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-654s1c1
Sequence:CCGGCGTCAGTAACCCTATTACCATCTCGAGATGGTAATAGGGTTACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-653s1c1
Sequence:CCGGGCGTCAGTAACCCTATTACCACTCGAGTGGTAATAGGGTTACTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-1276s1c1
Sequence:CCGGGTGCCCTTCAACAACCAGTATCTCGAGATACTGGTTGTTGAAGGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-1299s1c1
Sequence:CCGGGCACATCTCGATGCTGGATTACTCGAGTAATCCAGCATCGAGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173777
OLFM2 MISSION shRNA Lentiviral Transduction Particles
olfactomedin 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173777.3-459s21c1
Sequence:CCGGAGCAGACACACGAACCATTGTCTCGAGACAATGGTTCGTGTGTCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173777.3-296s21c1
Sequence:CCGGCATTCCGGGATCTCCAGTATGCTCGAGCATACTGGAGATCCCGGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173777.3-1209s21c1
Sequence:CCGGCAAGGTCTACTTTGCGTACTTCTCGAGAAGTACGCAAAGTAGACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173777.2-1531s1c1
Sequence:CCGGCCCAGCTTTCTGTTCTCAGTACTCGAGTACTGAGAACAGAAAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-654s1c1
Sequence:CCGGCGTCAGTAACCCTATTACCATCTCGAGATGGTAATAGGGTTACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-653s1c1
Sequence:CCGGGCGTCAGTAACCCTATTACCACTCGAGTGGTAATAGGGTTACTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-1276s1c1
Sequence:CCGGGTGCCCTTCAACAACCAGTATCTCGAGATACTGGTTGTTGAAGGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173777.2-1299s1c1
Sequence:CCGGGCACATCTCGATGCTGGATTACTCGAGTAATCCAGCATCGAGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058164
OLFM2 MISSION shRNA Bacterial Glycerol Stock
olfactomedin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058164.2-1198s21c1
Sequence:CCGGCAAGGTCTACTTCGCCTATTTCTCGAGAAATAGGCGAAGTAGACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058164.2-780s21c1
Sequence:CCGGTCATCAAAGGCCAGAACTTTACTCGAGTAAAGTTCTGGCCTTTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058164.2-718s21c1
Sequence:CCGGCTGGTACATGGATGGCTATTACTCGAGTAATAGCCATCCATGTACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-856s1c1
Sequence:CCGGCGGCTCCCTGTTCTATAACAACTCGAGTTGTTATAGAACAGGGAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189139    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058164.1-1654s1c1
Sequence:CCGGGCTCTGGTTCTCCAGTTCTTTCTCGAGAAAGAACTGGAGAACCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058164.1-1539s1c1
Sequence:CCGGGCCTATGTATTTCTGTCTATTCTCGAGAATAGACAGAAATACATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-1345s1c1
Sequence:CCGGGCTCTACAATGTCACCCTGTTCTCGAGAACAGGGTGACATTGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-1261s1c1
Sequence:CCGGCCACAACCAGTATTCCCACATCTCGAGATGTGGGAATACTGGTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-889s1c1
Sequence:CCGGCGTGGTGGTCAAATACCACTTCTCGAGAAGTGGTATTTGACCACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-781s1c1
Sequence:CCGGCTTCATCAAAGGCCAGAACTTCTCGAGAAGTTCTGGCCTTTGATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058164
OLFM2 MISSION shRNA shRNA Plasmid DNA
olfactomedin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058164.2-1198s21c1
Sequence:CCGGCAAGGTCTACTTCGCCTATTTCTCGAGAAATAGGCGAAGTAGACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058164.2-780s21c1
Sequence:CCGGTCATCAAAGGCCAGAACTTTACTCGAGTAAAGTTCTGGCCTTTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058164.2-718s21c1
Sequence:CCGGCTGGTACATGGATGGCTATTACTCGAGTAATAGCCATCCATGTACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-856s1c1
Sequence:CCGGCGGCTCCCTGTTCTATAACAACTCGAGTTGTTATAGAACAGGGAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189139    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058164.1-1654s1c1
Sequence:CCGGGCTCTGGTTCTCCAGTTCTTTCTCGAGAAAGAACTGGAGAACCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058164.1-1539s1c1
Sequence:CCGGGCCTATGTATTTCTGTCTATTCTCGAGAATAGACAGAAATACATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-1345s1c1
Sequence:CCGGGCTCTACAATGTCACCCTGTTCTCGAGAACAGGGTGACATTGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-1261s1c1
Sequence:CCGGCCACAACCAGTATTCCCACATCTCGAGATGTGGGAATACTGGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-889s1c1
Sequence:CCGGCGTGGTGGTCAAATACCACTTCTCGAGAAGTGGTATTTGACCACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-781s1c1
Sequence:CCGGCTTCATCAAAGGCCAGAACTTCTCGAGAAGTTCTGGCCTTTGATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058164
OLFM2 MISSION shRNA Lentiviral Transduction Particles
olfactomedin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058164.2-1198s21c1
Sequence:CCGGCAAGGTCTACTTCGCCTATTTCTCGAGAAATAGGCGAAGTAGACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058164.2-780s21c1
Sequence:CCGGTCATCAAAGGCCAGAACTTTACTCGAGTAAAGTTCTGGCCTTTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058164.2-718s21c1
Sequence:CCGGCTGGTACATGGATGGCTATTACTCGAGTAATAGCCATCCATGTACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-856s1c1
Sequence:CCGGCGGCTCCCTGTTCTATAACAACTCGAGTTGTTATAGAACAGGGAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189139    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058164.1-1654s1c1
Sequence:CCGGGCTCTGGTTCTCCAGTTCTTTCTCGAGAAAGAACTGGAGAACCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058164.1-1539s1c1
Sequence:CCGGGCCTATGTATTTCTGTCTATTCTCGAGAATAGACAGAAATACATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-1345s1c1
Sequence:CCGGGCTCTACAATGTCACCCTGTTCTCGAGAACAGGGTGACATTGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-1261s1c1
Sequence:CCGGCCACAACCAGTATTCCCACATCTCGAGATGTGGGAATACTGGTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-889s1c1
Sequence:CCGGCGTGGTGGTCAAATACCACTTCTCGAGAAGTGGTATTTGACCACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058164.1-781s1c1
Sequence:CCGGCTTCATCAAAGGCCAGAACTTCTCGAGAAGTTCTGGCCTTTGATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)