EMAIL THIS PAGE TO A FRIEND

OLFML1

olfactomedin-like 1

95 Gene Product Result for
Synonyms: UNQ564
UniProtKB ID: Q6UWY5, B4DP03, Q569G4
Gene ID:
Mouse(244198) olfactomedin-like 1
Rat(361621) olfactomedin-like 1
sheep(101112085) olfactomedin-like 1
domestic guinea pig(100723778) olfactomedin-like 1
naked mole-rat(101701803) olfactomedin-like 1
Domestic Rabbit(100338962) olfactomedin-like 1
chicken(428842) olfactomedin-like 1
dog(476839) olfactomedin-like 1
Horse(100055341) olfactomedin-like 1
cow(531068) olfactomedin-like 1
domestic cat(101081831) olfactomedin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198474 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198474 Rosetta Predictions human pricing
NM_001013192 Rosetta Predictions rat pricing
NM_172907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182628 predicted 374
2 SASI_Hs01_00182629 predicted 498
3 SASI_Hs01_00182631 predicted 890
4 SASI_Hs01_00182632 predicted 637
5 SASI_Hs01_00182633 predicted 1031
6 SASI_Hs02_00372007 predicted 1634
7 SASI_Hs01_00182635 predicted 860
8 SASI_Hs01_00182636 predicted 926
9 SASI_Hs01_00182637 predicted 1324
10 SASI_Hs02_00372008 predicted 963
11 SASI_Hs01_00182630 predicted 528
12 SASI_Hs01_00182634 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105983 predicted 453
2 SASI_Rn01_00105984 predicted 727
3 SASI_Rn01_00105985 predicted 930
4 SASI_Rn01_00105986 predicted 817
5 SASI_Rn01_00105987 predicted 843
6 SASI_Rn02_00200954 predicted 1518
7 SASI_Rn02_00200955 predicted 1578
8 SASI_Rn01_00105988 predicted 980
9 SASI_Rn01_00105989 predicted 534
10 SASI_Rn01_00105990 predicted 854
11 SASI_Rn01_00105991 predicted 629
12 SASI_Rn01_00105992 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344893 predicted 1024
2 SASI_Mm01_00167921 predicted 984
3 SASI_Mm01_00167922 predicted 857
4 SASI_Mm01_00167923 predicted 1020
5 SASI_Mm01_00167924 predicted 561
6 SASI_Mm01_00167925 predicted 1014
7 SASI_Mm01_00167926 predicted 943
8 SASI_Mm01_00167927 predicted 960
9 SASI_Mm01_00167928 predicted 876
10 SASI_Mm01_00167929 predicted 479
11 SASI_Mm01_00167930 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198474
OLFML1 MISSION shRNA Bacterial Glycerol Stock
olfactomedin-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-1405s1c1
Sequence:CCGGCCCTCTAATCACACACAGGAACTCGAGTTCCTGTGTGTGATTAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-398s1c1
Sequence:CCGGCGGGAGATTGACTACATACAACTCGAGTTGTATGTAGTCAATCTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-722s1c1
Sequence:CCGGCGGAAGCAAATCCTAACACTTCTCGAGAAGTGTTAGGATTTGCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-998s21c1
Sequence:CCGGGGATGAAAGATGCTGTCTATACTCGAGTATAGACAGCATCTTTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-205s1c1
Sequence:CCGGGCATTACATCTACCAGCGCTTCTCGAGAAGCGCTGGTAGATGTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-1055s21c1
Sequence:CCGGACAACACTGTTTGGGAATTTGCTCGAGCAAATTCCCAAACAGTGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-1198s21c1
Sequence:CCGGGCAACTTCTAATGAGATAATCCTCGAGGATTATCTCATTAGAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-1540s21c1
Sequence:CCGGTATGATCCACTGGGCACTATCCTCGAGGATAGTGCCCAGTGGATCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198474
OLFML1 MISSION shRNA shRNA Plasmid DNA
olfactomedin-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-1405s1c1
Sequence:CCGGCCCTCTAATCACACACAGGAACTCGAGTTCCTGTGTGTGATTAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-398s1c1
Sequence:CCGGCGGGAGATTGACTACATACAACTCGAGTTGTATGTAGTCAATCTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-722s1c1
Sequence:CCGGCGGAAGCAAATCCTAACACTTCTCGAGAAGTGTTAGGATTTGCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-998s21c1
Sequence:CCGGGGATGAAAGATGCTGTCTATACTCGAGTATAGACAGCATCTTTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-205s1c1
Sequence:CCGGGCATTACATCTACCAGCGCTTCTCGAGAAGCGCTGGTAGATGTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-1055s21c1
Sequence:CCGGACAACACTGTTTGGGAATTTGCTCGAGCAAATTCCCAAACAGTGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-1198s21c1
Sequence:CCGGGCAACTTCTAATGAGATAATCCTCGAGGATTATCTCATTAGAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-1540s21c1
Sequence:CCGGTATGATCCACTGGGCACTATCCTCGAGGATAGTGCCCAGTGGATCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198474
OLFML1 MISSION shRNA Lentiviral Transduction Particles
olfactomedin-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-1405s1c1
Sequence:CCGGCCCTCTAATCACACACAGGAACTCGAGTTCCTGTGTGTGATTAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-398s1c1
Sequence:CCGGCGGGAGATTGACTACATACAACTCGAGTTGTATGTAGTCAATCTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-722s1c1
Sequence:CCGGCGGAAGCAAATCCTAACACTTCTCGAGAAGTGTTAGGATTTGCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-998s21c1
Sequence:CCGGGGATGAAAGATGCTGTCTATACTCGAGTATAGACAGCATCTTTCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198474.1-205s1c1
Sequence:CCGGGCATTACATCTACCAGCGCTTCTCGAGAAGCGCTGGTAGATGTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-1055s21c1
Sequence:CCGGACAACACTGTTTGGGAATTTGCTCGAGCAAATTCCCAAACAGTGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-1198s21c1
Sequence:CCGGGCAACTTCTAATGAGATAATCCTCGAGGATTATCTCATTAGAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198474.3-1540s21c1
Sequence:CCGGTATGATCCACTGGGCACTATCCTCGAGGATAGTGCCCAGTGGATCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172907
OLFML1 MISSION shRNA Bacterial Glycerol Stock
olfactomedin-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172907.3-1486s21c1
Sequence:CCGGTGAAGGCAATCAGATCATTTACTCGAGTAAATGATCTGATTGCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-1025s21c1
Sequence:CCGGGGAACTTCTAATGAGATAATTCTCGAGAATTATCTCATTAGAAGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-483s21c1
Sequence:CCGGCCAAACAACAAGGGCATATATCTCGAGATATATGCCCTTGTTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-558s21c1
Sequence:CCGGGACCCACACAAGTGAATATAACTCGAGTTATATTCACTTGTGTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-990s21c1
Sequence:CCGGGGTCTACCAAAGCTTTCTATTCTCGAGAATAGAAAGCTTTGGTAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172907
OLFML1 MISSION shRNA shRNA Plasmid DNA
olfactomedin-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172907.3-1486s21c1
Sequence:CCGGTGAAGGCAATCAGATCATTTACTCGAGTAAATGATCTGATTGCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-1025s21c1
Sequence:CCGGGGAACTTCTAATGAGATAATTCTCGAGAATTATCTCATTAGAAGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-483s21c1
Sequence:CCGGCCAAACAACAAGGGCATATATCTCGAGATATATGCCCTTGTTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-558s21c1
Sequence:CCGGGACCCACACAAGTGAATATAACTCGAGTTATATTCACTTGTGTGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-990s21c1
Sequence:CCGGGGTCTACCAAAGCTTTCTATTCTCGAGAATAGAAAGCTTTGGTAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172907
OLFML1 MISSION shRNA Lentiviral Transduction Particles
olfactomedin-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172907.3-1486s21c1
Sequence:CCGGTGAAGGCAATCAGATCATTTACTCGAGTAAATGATCTGATTGCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-1025s21c1
Sequence:CCGGGGAACTTCTAATGAGATAATTCTCGAGAATTATCTCATTAGAAGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-483s21c1
Sequence:CCGGCCAAACAACAAGGGCATATATCTCGAGATATATGCCCTTGTTGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-558s21c1
Sequence:CCGGGACCCACACAAGTGAATATAACTCGAGTTATATTCACTTGTGTGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172907.3-990s21c1
Sequence:CCGGGGTCTACCAAAGCTTTCTATTCTCGAGAATAGAAAGCTTTGGTAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)