EMAIL THIS PAGE TO A FRIEND

OLFML2B

olfactomedin-like 2B

80 Gene Product Result for
Synonyms: RP11-227F8.1
UniProtKB ID: Q68BL8, B7ZA39, Q5VU96, Q6NX46, Q86X11, Q9Y3X6
Gene ID:
Mouse(320078) olfactomedin-like 2B
Rat(304960) olfactomedin-like 2B
sheep(101107748) olfactomedin-like 2B
domestic guinea pig(100716244) olfactomedin-like 2B
naked mole-rat(101707195) olfactomedin-like 2B
Domestic Rabbit(100338751) olfactomedin-like 2B
Zebrafish(567907) olfactomedin-like 2B
cow(513053) olfactomedin-like 2B
domestic cat(101087039) olfactomedin-like 2B
dog(488661) olfactomedin-like 2B
chicken(424366) olfactomedin-like 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015441 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036381 MISSION® esiRNA esiRNA human OLFML2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015441 Rosetta Predictions human pricing
NM_001107195 Rosetta Predictions rat pricing
NM_177068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023360 predicted 1936
2 SASI_Hs01_00023361 predicted 1017
3 SASI_Hs02_00347827 predicted 1030
4 SASI_Hs01_00023362 predicted 1013
5 SASI_Hs01_00023363 predicted 1939
6 SASI_Hs01_00023364 predicted 850
7 SASI_Hs01_00023365 predicted 1033
8 SASI_Hs01_00023366 predicted 886
9 SASI_Hs01_00023367 predicted 605
10 SASI_Hs01_00023368 predicted 723
11 SASI_Hs01_00023369 predicted 2295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226445 predicted 1495
2 SASI_Rn02_00226446 predicted 1390
3 SASI_Rn02_00226447 predicted 1908
4 SASI_Rn02_00226448 predicted 1148
5 SASI_Rn02_00226449 predicted 824
6 SASI_Rn02_00226450 predicted 587
7 SASI_Rn02_00226451 predicted 2055
8 SASI_Rn02_00226452 predicted 899
9 SASI_Rn02_00226453 predicted 1633
10 SASI_Rn02_00226454 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060857 predicted 843
2 SASI_Mm01_00060858 predicted 1085
3 SASI_Mm01_00060859 predicted 281
4 SASI_Mm01_00060860 predicted 2004
5 SASI_Mm01_00060861 predicted 680
6 SASI_Mm01_00060862 predicted 1264
7 SASI_Mm01_00060863 predicted 594
8 SASI_Mm01_00060864 predicted 1540
9 SASI_Mm01_00060865 predicted 2148
10 SASI_Mm01_00060866 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177068
VALIDATED
OLFML2B MISSION shRNA Bacterial Glycerol Stock
olfactomedin-like 2B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000185311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177068.3-1668s1c1
Sequence:CCGGGCATTTACGTAACCAACTATTCTCGAGAATAGTTGGTTACGTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-2428s21c1
Sequence:CCGGTATGCTGTGGACAGCTATAACCTCGAGGTTATAGCTGTCCACAGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-2773s21c1
Sequence:CCGGATGACAGTTTGGGTCTATATTCTCGAGAATATAGACCCAAACTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177068.3-530s1c1
Sequence:CCGGGATTTGAAGCTGTCTACAATTCTCGAGAATTGTAGACAGCTTCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177068.3-1833s1c1
Sequence:CCGGCCCGAAACATCATCAAGTATGCTCGAGCATACTTGATGATGTTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-1964s21c1
Sequence:CCGGACGTAACCAACTATTACTATGCTCGAGCATAGTAATAGTTGGTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-2140s21c1
Sequence:CCGGTATGACCTGAAGCAGCGTTATCTCGAGATAACGCTGCTTCAGGTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-823s21c1
Sequence:CCGGTTGAAGCTGTCTACAATTATACTCGAGTATAATTGTAGACAGCTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177068
VALIDATED
OLFML2B MISSION shRNA shRNA Plasmid DNA
olfactomedin-like 2B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000185311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177068.3-1668s1c1
Sequence:CCGGGCATTTACGTAACCAACTATTCTCGAGAATAGTTGGTTACGTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-2428s21c1
Sequence:CCGGTATGCTGTGGACAGCTATAACCTCGAGGTTATAGCTGTCCACAGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-2773s21c1
Sequence:CCGGATGACAGTTTGGGTCTATATTCTCGAGAATATAGACCCAAACTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177068.3-530s1c1
Sequence:CCGGGATTTGAAGCTGTCTACAATTCTCGAGAATTGTAGACAGCTTCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177068.3-1833s1c1
Sequence:CCGGCCCGAAACATCATCAAGTATGCTCGAGCATACTTGATGATGTTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-1964s21c1
Sequence:CCGGACGTAACCAACTATTACTATGCTCGAGCATAGTAATAGTTGGTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-2140s21c1
Sequence:CCGGTATGACCTGAAGCAGCGTTATCTCGAGATAACGCTGCTTCAGGTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-823s21c1
Sequence:CCGGTTGAAGCTGTCTACAATTATACTCGAGTATAATTGTAGACAGCTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177068
VALIDATED
OLFML2B MISSION shRNA Lentiviral Transduction Particles
olfactomedin-like 2B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000185311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177068.3-1668s1c1
Sequence:CCGGGCATTTACGTAACCAACTATTCTCGAGAATAGTTGGTTACGTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-2428s21c1
Sequence:CCGGTATGCTGTGGACAGCTATAACCTCGAGGTTATAGCTGTCCACAGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-2773s21c1
Sequence:CCGGATGACAGTTTGGGTCTATATTCTCGAGAATATAGACCCAAACTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177068.3-530s1c1
Sequence:CCGGGATTTGAAGCTGTCTACAATTCTCGAGAATTGTAGACAGCTTCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177068.3-1833s1c1
Sequence:CCGGCCCGAAACATCATCAAGTATGCTCGAGCATACTTGATGATGTTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-1964s21c1
Sequence:CCGGACGTAACCAACTATTACTATGCTCGAGCATAGTAATAGTTGGTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-2140s21c1
Sequence:CCGGTATGACCTGAAGCAGCGTTATCTCGAGATAACGCTGCTTCAGGTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177068.4-823s21c1
Sequence:CCGGTTGAAGCTGTCTACAATTATACTCGAGTATAATTGTAGACAGCTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015441
OLFML2B MISSION shRNA Bacterial Glycerol Stock
olfactomedin-like 2B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015441.1-3048s1c1
Sequence:CCGGGAGGCAAGAAAGAAGTGCTATCTCGAGATAGCACTTCTTTCTTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-1142s1c1
Sequence:CCGGCCAGAGTATGAAGAGCGGTTTCTCGAGAAACCGCTCTTCATACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-1036s1c1
Sequence:CCGGCGAGATGAATAAGCGAGGCAACTCGAGTTGCCTCGCTTATTCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-1390s1c1
Sequence:CCGGCGGTGACAATGGAGTGGATTTCTCGAGAAATCCACTCCATTGTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-2644s1c1
Sequence:CCGGCCAGGTCACTTACCATGTCATCTCGAGATGACATGGTAAGTGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-684s21c1
Sequence:CCGGATGCCTGCCAGAGGATCAATGCTCGAGCATTGATCCTCTGGCAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-2005s21c1
Sequence:CCGGGATTTACGTAACCAACTATTACTCGAGTAATAGTTGGTTACGTAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-1028s21c1
Sequence:GTACCGGATTCGAACCGAGATGAATAAGCTCGAGCTTATTCATCTCGGTTCGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015441.1-2848s21c1
Sequence:CCGGAGATCAATCCATACGTGTATGCTCGAGCATACACGTATGGATTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-858s21c1
Sequence:CCGGTGAAGCTCTCCACAATCATAGCTCGAGCTATGATTGTGGAGAGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015441
OLFML2B MISSION shRNA shRNA Plasmid DNA
olfactomedin-like 2B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015441.1-3048s1c1
Sequence:CCGGGAGGCAAGAAAGAAGTGCTATCTCGAGATAGCACTTCTTTCTTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-1142s1c1
Sequence:CCGGCCAGAGTATGAAGAGCGGTTTCTCGAGAAACCGCTCTTCATACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-1036s1c1
Sequence:CCGGCGAGATGAATAAGCGAGGCAACTCGAGTTGCCTCGCTTATTCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-1390s1c1
Sequence:CCGGCGGTGACAATGGAGTGGATTTCTCGAGAAATCCACTCCATTGTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-2644s1c1
Sequence:CCGGCCAGGTCACTTACCATGTCATCTCGAGATGACATGGTAAGTGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-684s21c1
Sequence:CCGGATGCCTGCCAGAGGATCAATGCTCGAGCATTGATCCTCTGGCAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-2005s21c1
Sequence:CCGGGATTTACGTAACCAACTATTACTCGAGTAATAGTTGGTTACGTAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-1028s21c1
Sequence:GTACCGGATTCGAACCGAGATGAATAAGCTCGAGCTTATTCATCTCGGTTCGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015441.1-2848s21c1
Sequence:CCGGAGATCAATCCATACGTGTATGCTCGAGCATACACGTATGGATTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-858s21c1
Sequence:CCGGTGAAGCTCTCCACAATCATAGCTCGAGCTATGATTGTGGAGAGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015441
OLFML2B MISSION shRNA Lentiviral Transduction Particles
olfactomedin-like 2B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015441.1-3048s1c1
Sequence:CCGGGAGGCAAGAAAGAAGTGCTATCTCGAGATAGCACTTCTTTCTTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-1142s1c1
Sequence:CCGGCCAGAGTATGAAGAGCGGTTTCTCGAGAAACCGCTCTTCATACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-1036s1c1
Sequence:CCGGCGAGATGAATAAGCGAGGCAACTCGAGTTGCCTCGCTTATTCATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-1390s1c1
Sequence:CCGGCGGTGACAATGGAGTGGATTTCTCGAGAAATCCACTCCATTGTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015441.1-2644s1c1
Sequence:CCGGCCAGGTCACTTACCATGTCATCTCGAGATGACATGGTAAGTGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-684s21c1
Sequence:CCGGATGCCTGCCAGAGGATCAATGCTCGAGCATTGATCCTCTGGCAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-2005s21c1
Sequence:CCGGGATTTACGTAACCAACTATTACTCGAGTAATAGTTGGTTACGTAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-1028s21c1
Sequence:GTACCGGATTCGAACCGAGATGAATAAGCTCGAGCTTATTCATCTCGGTTCGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015441.1-2848s21c1
Sequence:CCGGAGATCAATCCATACGTGTATGCTCGAGCATACACGTATGGATTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015441.1-858s21c1
Sequence:CCGGTGAAGCTCTCCACAATCATAGCTCGAGCTATGATTGTGGAGAGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)