EMAIL THIS PAGE TO A FRIEND

OLIG1

oligodendrocyte transcription factor 1

50 Gene Product Result for
Synonyms: BHLHB6 BHLHE21
UniProtKB ID: Q8TAK6, Q7RTS0
Gene ID:
Mouse(50914) oligodendrocyte transcription factor 1
Rat(60394) oligodendrocyte transcription factor 1
Zebrafish(100001484) oligodendrocyte lineage transcription factor 1
dog(487736) oligodendrocyte transcription factor 1
cow(539307) oligodendrocyte transcription factor 1
domestic guinea pig(101787119) oligodendrocyte transcription factor 1
naked mole-rat(101722035) oligodendrocyte transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138983 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014531 MISSION® esiRNA esiRNA targeting mouse Olig1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138983 Rosetta Predictions human pricing
NM_021770 Rosetta Predictions rat pricing
NM_016968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072855 predicted 1930
2 SASI_Hs01_00072856 predicted 1989
3 SASI_Hs01_00072857 predicted 2041
4 SASI_Hs01_00072858 predicted 1955
5 SASI_Hs01_00072859 predicted 1639
6 SASI_Hs01_00072862 predicted 2056
7 SASI_Hs01_00072863 predicted 1640
8 SASI_Hs01_00072864 predicted 1960
9 SASI_Hs02_00364026 predicted 1748
10 SASI_Hs02_00364027 predicted 1588
11 SASI_Hs01_00072860 predicted 1501
12 SASI_Hs01_00072861 predicted 1756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104635 predicted 1068
2 SASI_Rn02_00262832 predicted 1302
3 SASI_Rn01_00104636 predicted 485
4 SASI_Rn01_00104637 predicted 1043
5 SASI_Rn01_00104638 predicted 442
6 SASI_Rn01_00104639 predicted 235
7 SASI_Rn01_00104640 predicted 280
8 SASI_Rn01_00104641 predicted 526
9 SASI_Rn01_00104642 predicted 199
10 SASI_Rn01_00104643 predicted 989
11 SASI_Rn01_00104644 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040360 predicted 1084
2 SASI_Mm01_00040361 predicted 208
3 SASI_Mm01_00040362 predicted 1065
4 SASI_Mm01_00040363 predicted 1189
5 SASI_Mm01_00040364 predicted 439
6 SASI_Mm01_00040365 predicted 228
7 SASI_Mm01_00040366 predicted 217
8 SASI_Mm01_00040367 predicted 457
9 SASI_Mm01_00040368 predicted 196
10 SASI_Mm01_00040369 predicted 756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016968
OLIG1 MISSION shRNA Bacterial Glycerol Stock
oligodendrocyte transcription factor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-817s1c1
Sequence:CCGGGCGGTGTGCAAGTTCCCGCATCTCGAGATGCGGGAACTTGCACACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-150s1c1
Sequence:CCGGCGCGACCATGTTGCGGCCACACTCGAGTGTGGCCGCAACATGGTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-360s1c1
Sequence:CCGGCGACGCCAAAGAGGAACAGCACTCGAGTGCTGTTCCTCTTTGGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016968.4-1085s1c1
Sequence:CCGGGCGATGTAGTTGCTTGGGATTCTCGAGAATCCCAAGCAACTACATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-459s1c1
Sequence:CCGGGCGCGAAGTTATCCTACCCTACTCGAGTAGGGTAGGATAACTTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016968.4-1120s21c1
Sequence:CCGGCCTGTTTAGAGCCAGAAGTCTCTCGAGAGACTTCTGGCTCTAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016968.4-425s21c1
Sequence:CCGGGCATGCAGGACCTGAACTTGGCTCGAGCCAAGTTCAGGTCCTGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016968.4-724s21c1
Sequence:CCGGACCAAGTACCTGTCTCTAGCGCTCGAGCGCTAGAGACAGGTACTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016968
OLIG1 MISSION shRNA shRNA Plasmid DNA
oligodendrocyte transcription factor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-817s1c1
Sequence:CCGGGCGGTGTGCAAGTTCCCGCATCTCGAGATGCGGGAACTTGCACACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-150s1c1
Sequence:CCGGCGCGACCATGTTGCGGCCACACTCGAGTGTGGCCGCAACATGGTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-360s1c1
Sequence:CCGGCGACGCCAAAGAGGAACAGCACTCGAGTGCTGTTCCTCTTTGGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016968.4-1085s1c1
Sequence:CCGGGCGATGTAGTTGCTTGGGATTCTCGAGAATCCCAAGCAACTACATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-459s1c1
Sequence:CCGGGCGCGAAGTTATCCTACCCTACTCGAGTAGGGTAGGATAACTTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016968.4-1120s21c1
Sequence:CCGGCCTGTTTAGAGCCAGAAGTCTCTCGAGAGACTTCTGGCTCTAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016968.4-425s21c1
Sequence:CCGGGCATGCAGGACCTGAACTTGGCTCGAGCCAAGTTCAGGTCCTGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016968.4-724s21c1
Sequence:CCGGACCAAGTACCTGTCTCTAGCGCTCGAGCGCTAGAGACAGGTACTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016968
OLIG1 MISSION shRNA Lentiviral Transduction Particles
oligodendrocyte transcription factor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-817s1c1
Sequence:CCGGGCGGTGTGCAAGTTCCCGCATCTCGAGATGCGGGAACTTGCACACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-150s1c1
Sequence:CCGGCGCGACCATGTTGCGGCCACACTCGAGTGTGGCCGCAACATGGTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-360s1c1
Sequence:CCGGCGACGCCAAAGAGGAACAGCACTCGAGTGCTGTTCCTCTTTGGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016968.4-1085s1c1
Sequence:CCGGGCGATGTAGTTGCTTGGGATTCTCGAGAATCCCAAGCAACTACATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016968.4-459s1c1
Sequence:CCGGGCGCGAAGTTATCCTACCCTACTCGAGTAGGGTAGGATAACTTCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016968.4-1120s21c1
Sequence:CCGGCCTGTTTAGAGCCAGAAGTCTCTCGAGAGACTTCTGGCTCTAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016968.4-425s21c1
Sequence:CCGGGCATGCAGGACCTGAACTTGGCTCGAGCCAAGTTCAGGTCCTGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016968.4-724s21c1
Sequence:CCGGACCAAGTACCTGTCTCTAGCGCTCGAGCGCTAGAGACAGGTACTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138983
OLIG1 MISSION shRNA Bacterial Glycerol Stock
oligodendrocyte transcription factor 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138983.1-451s1c1
Sequence:CCGGCCGCAACTACATCCTACTGCTCTCGAGAGCAGTAGGATGTAGTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138983.1-768s1c1
Sequence:CCGGCCGCCGTGCAGGCGCAATTCTCTCGAGAGAATTGCGCCTGCACGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138983.1-72s1c1
Sequence:CCGGCCCTCTACGAGCTGGTGGGCTCTCGAGAGCCCACCAGCTCGTAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138983.2-448s21c1
Sequence:CCGGGAAGCGCATGCAGGACCTGAACTCGAGTTCAGGTCCTGCATGCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138983.2-1096s21c1
Sequence:CCGGTAAAGTGACCAGAGCGGATGTCTCGAGACATCCGCTCTGGTCACTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138983.2-1010s21c1
Sequence:CCGGGCCGAGCAAGGAAAGCATTTCCTCGAGGAAATGCTTTCCTTGCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138983
OLIG1 MISSION shRNA shRNA Plasmid DNA
oligodendrocyte transcription factor 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138983.1-451s1c1
Sequence:CCGGCCGCAACTACATCCTACTGCTCTCGAGAGCAGTAGGATGTAGTTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138983.1-768s1c1
Sequence:CCGGCCGCCGTGCAGGCGCAATTCTCTCGAGAGAATTGCGCCTGCACGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138983.1-72s1c1
Sequence:CCGGCCCTCTACGAGCTGGTGGGCTCTCGAGAGCCCACCAGCTCGTAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138983.2-448s21c1
Sequence:CCGGGAAGCGCATGCAGGACCTGAACTCGAGTTCAGGTCCTGCATGCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138983.2-1096s21c1
Sequence:CCGGTAAAGTGACCAGAGCGGATGTCTCGAGACATCCGCTCTGGTCACTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138983.2-1010s21c1
Sequence:CCGGGCCGAGCAAGGAAAGCATTTCCTCGAGGAAATGCTTTCCTTGCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138983
OLIG1 MISSION shRNA Lentiviral Transduction Particles
oligodendrocyte transcription factor 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138983.1-451s1c1
Sequence:CCGGCCGCAACTACATCCTACTGCTCTCGAGAGCAGTAGGATGTAGTTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138983.1-768s1c1
Sequence:CCGGCCGCCGTGCAGGCGCAATTCTCTCGAGAGAATTGCGCCTGCACGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138983.1-72s1c1
Sequence:CCGGCCCTCTACGAGCTGGTGGGCTCTCGAGAGCCCACCAGCTCGTAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138983.2-448s21c1
Sequence:CCGGGAAGCGCATGCAGGACCTGAACTCGAGTTCAGGTCCTGCATGCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138983.2-1096s21c1
Sequence:CCGGTAAAGTGACCAGAGCGGATGTCTCGAGACATCCGCTCTGGTCACTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138983.2-1010s21c1
Sequence:CCGGGCCGAGCAAGGAAAGCATTTCCTCGAGGAAATGCTTTCCTTGCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)