EMAIL THIS PAGE TO A FRIEND

OLIG2

oligodendrocyte lineage transcription factor 2

68 Gene Product Result for
Synonyms: BHLHB1 OLIGO2 PRKCBP2 RACK17 bHLHe19
UniProtKB ID: Q13516, B3KRF3, Q86X04, Q9NZ14
Gene ID:
Human(10215) Summary: This gene encodes a basic helix-loop-helix transcription factor which is expressed in oligodendroglial tumors of the brain. The protein is an essential regulator of ventral neuroectodermal progenitor cell fate. The gene is involved in a chromosomal translocation t(14;21)(q11.2;q22) associated with T-cell acute lymphoblastic leukemia. Its chromosomal location is within a region of chromosome 21 which has been suggested to play a role in learning deficits associated with Down syndrome. [provided by RefSeq, Jul 2008]
Mouse(50913) oligodendrocyte transcription factor 2
Rat(304103) oligodendrocyte lineage transcription factor 2
naked mole-rat(101721679) oligodendrocyte lineage transcription factor 2
domestic guinea pig(100716627) oligodendrocyte lineage transcription factor 2
Zebrafish(325288) oligodendrocyte lineage transcription factor 2
cow(539695) oligodendrocyte lineage transcription factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AB9610 Anti-Olig-2 Antibody clone, Chemicon®, from rabbit mouse, rat, rat, human, human, mouse
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
AV32753 Anti-OLIG2 (AB1) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
AV31464 Anti-OLIG2 (AB2) antibody produced in rabbit affinity isolated antibody horse, guinea pig, dog, rat, human, mouse
immunohistochemistry, western blot pricing
AV32752 Anti-OLIG2 (AB3) antibody produced in rabbit affinity isolated antibody horse, rat, human, mouse, dog
immunohistochemistry, western blot pricing
AB15328 Anti-Olig2 Antibody clone, Chemicon®, from rabbit rat
western blot pricing
SAB1412293 ANTI-OLIG2 antibody produced in mouse clone 2A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1412294 ANTI-OLIG2 antibody produced in mouse clone 2B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
HPA003254 Anti-OLIG2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
MABN50 Anti-Olig2 Antibody, clone 211F1.1 clone 211F1.1, from mouse mouse, rat, mouse, human, mouse
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MABN50A4 Anti-Olig2 Antibody, clone 211F1.1, Alexa Fluor488 Conjugate | MABN50A4 clone 211F1.1, from mouse, ALEXA FLUOR® 488 rat, mouse, mouse, human, rat
immunocytochemistry pricing
SAB1404798 Monoclonal Anti-OLIG2 antibody produced in mouse clone 3C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0010215M2 Monoclonal Anti-OLIG2 antibody produced in mouse clone 3D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB5300407 Monoclonal Anti-OLIG2 antibody produced in mouse clone 1G11, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005806 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016967 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016967 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016967 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005806 Rosetta Predictions human pricing
XM_001073459 Rosetta Predictions rat pricing
XM_221668 Rosetta Predictions rat pricing
NM_016967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092187 predicted 443
2 SASI_Hs02_00340317 predicted 1318
3 SASI_Hs01_00092188 predicted 1836
4 SASI_Hs01_00092190 predicted 2055
5 SASI_Hs01_00092191 predicted 1870
6 SASI_Hs01_00092192 predicted 1846
7 SASI_Hs02_00340318 predicted 2130
8 SASI_Hs01_00092194 predicted 1858
9 SASI_Hs01_00092195 predicted 1989
10 SASI_Hs01_00092196 predicted 1750
11 SASI_Hs01_00092189 predicted 2405
12 SASI_Hs01_00092193 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342946 predicted 1359
2 SASI_Rn02_00342947 predicted 1405
3 SASI_Rn02_00342948 predicted 462
4 SASI_Rn02_00342949 predicted 1685
5 SASI_Rn02_00342950 predicted 1484
6 SASI_Rn02_00342951 predicted 1414
7 SASI_Rn02_00342952 predicted 1670
8 SASI_Rn02_00342953 predicted 1344
9 SASI_Rn02_00342954 predicted 623
10 SASI_Rn02_00342955 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380271 predicted 1402
2 SASI_Rn02_00380272 predicted 1456
3 SASI_Rn02_00380273 predicted 1411
4 SASI_Rn02_00380274 predicted 1482
5 SASI_Rn02_00380275 predicted 1734
6 SASI_Rn02_00380276 predicted 1538
7 SASI_Rn02_00380277 predicted 1466
8 SASI_Rn02_00380278 predicted 1719
9 SASI_Rn02_00380279 predicted 1393
10 SASI_Rn02_00380280 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159028 predicted 1446
2 SASI_Mm01_00159029 predicted 1325
3 SASI_Mm01_00159030 predicted 1389
4 SASI_Mm01_00159031 predicted 423
5 SASI_Mm01_00159032 predicted 1272
6 SASI_Mm01_00159033 predicted 1505
7 SASI_Mm01_00159034 predicted 1302
8 SASI_Mm01_00159035 predicted 1541
9 SASI_Mm01_00159036 predicted 1506
10 SASI_Mm01_00159037 predicted 1473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005806
OLIG2 MISSION shRNA Bacterial Glycerol Stock
oligodendrocyte lineage transcription factor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005806.2-481s21c1
Sequence:CCGGAGCTGCGTCTCAAGATCAACACTCGAGTGTTGATCTTGAGACGCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005806.2-1417s21c1
Sequence:CCGGGCATTCCTCACTAGAACTCATCTCGAGATGAGTTCTAGTGAGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005806.1-467s1c1
Sequence:CCGGGCACGACCTCAACATCGCCATCTCGAGATGGCGATGTTGAGGTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005806.1-1877s1c1
Sequence:CCGGGCGGGTGCATTGTAGTTATTACTCGAGTAATAACTACAATGCACCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005806.1-614s1c1
Sequence:CCGGGCGACTGGTGAGCGAGATCTACTCGAGTAGATCTCGCTCACCAGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005806.1-145s1c1
Sequence:CCGGCGCCAGAGCCCGATGACCTTTCTCGAGAAAGGTCATCGGGCTCTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005806.2-1274s21c1
Sequence:CCGGGCATCTGCGAACCCAAGCAATCTCGAGATTGCTTGGGTTCGCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005806
OLIG2 MISSION shRNA shRNA Plasmid DNA
oligodendrocyte lineage transcription factor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005806.2-481s21c1
Sequence:CCGGAGCTGCGTCTCAAGATCAACACTCGAGTGTTGATCTTGAGACGCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005806.2-1417s21c1
Sequence:CCGGGCATTCCTCACTAGAACTCATCTCGAGATGAGTTCTAGTGAGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005806.1-467s1c1
Sequence:CCGGGCACGACCTCAACATCGCCATCTCGAGATGGCGATGTTGAGGTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005806.1-1877s1c1
Sequence:CCGGGCGGGTGCATTGTAGTTATTACTCGAGTAATAACTACAATGCACCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005806.1-614s1c1
Sequence:CCGGGCGACTGGTGAGCGAGATCTACTCGAGTAGATCTCGCTCACCAGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005806.1-145s1c1
Sequence:CCGGCGCCAGAGCCCGATGACCTTTCTCGAGAAAGGTCATCGGGCTCTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005806.2-1274s21c1
Sequence:CCGGGCATCTGCGAACCCAAGCAATCTCGAGATTGCTTGGGTTCGCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005806
OLIG2 MISSION shRNA Lentiviral Transduction Particles
oligodendrocyte lineage transcription factor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005806.2-481s21c1
Sequence:CCGGAGCTGCGTCTCAAGATCAACACTCGAGTGTTGATCTTGAGACGCAGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000423392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005806.2-1417s21c1
Sequence:CCGGGCATTCCTCACTAGAACTCATCTCGAGATGAGTTCTAGTGAGGAATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005806.1-467s1c1
Sequence:CCGGGCACGACCTCAACATCGCCATCTCGAGATGGCGATGTTGAGGTCGTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005806.1-1877s1c1
Sequence:CCGGGCGGGTGCATTGTAGTTATTACTCGAGTAATAACTACAATGCACCCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005806.1-614s1c1
Sequence:CCGGGCGACTGGTGAGCGAGATCTACTCGAGTAGATCTCGCTCACCAGTCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005806.1-145s1c1
Sequence:CCGGCGCCAGAGCCCGATGACCTTTCTCGAGAAAGGTCATCGGGCTCTGGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005806.2-1274s21c1
Sequence:CCGGGCATCTGCGAACCCAAGCAATCTCGAGATTGCTTGGGTTCGCAGATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016967
OLIG2 MISSION shRNA Bacterial Glycerol Stock
oligodendrocyte lineage transcription factor 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016967.2-1648s1c1
Sequence:CCGGCGTGGGTATCAGAAGCACTTACTCGAGTAAGTGCTTCTGATACCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016967.2-624s1c1
Sequence:CCGGGCGAAACTACATCCTCATGCTCTCGAGAGCATGAGGATGTAGTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016967.2-427s1c1
Sequence:CCGGGCCACGTCTTCCACCAAGAAACTCGAGTTTCTTGGTGGAAGACGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016967.2-441s1c1
Sequence:CCGGCAAGAAAGACAAGAAGCAGATCTCGAGATCTGCTTCTTGTCTTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016967.2-1279s21c1
Sequence:CCGGACCGAAGCAATGGGAGCATTTCTCGAGAAATGCTCCCATTGCTTCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016967.2-1326s21c1
Sequence:CCGGCAGAACCTGGTTGACTCTTTGCTCGAGCAAAGAGTCAACCAGGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016967
OLIG2 MISSION shRNA shRNA Plasmid DNA
oligodendrocyte lineage transcription factor 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016967.2-1648s1c1
Sequence:CCGGCGTGGGTATCAGAAGCACTTACTCGAGTAAGTGCTTCTGATACCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016967.2-624s1c1
Sequence:CCGGGCGAAACTACATCCTCATGCTCTCGAGAGCATGAGGATGTAGTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016967.2-427s1c1
Sequence:CCGGGCCACGTCTTCCACCAAGAAACTCGAGTTTCTTGGTGGAAGACGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016967.2-441s1c1
Sequence:CCGGCAAGAAAGACAAGAAGCAGATCTCGAGATCTGCTTCTTGTCTTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016967.2-1279s21c1
Sequence:CCGGACCGAAGCAATGGGAGCATTTCTCGAGAAATGCTCCCATTGCTTCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016967.2-1326s21c1
Sequence:CCGGCAGAACCTGGTTGACTCTTTGCTCGAGCAAAGAGTCAACCAGGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016967
OLIG2 MISSION shRNA Lentiviral Transduction Particles
oligodendrocyte lineage transcription factor 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016967.2-1648s1c1
Sequence:CCGGCGTGGGTATCAGAAGCACTTACTCGAGTAAGTGCTTCTGATACCCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000096541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016967.2-624s1c1
Sequence:CCGGGCGAAACTACATCCTCATGCTCTCGAGAGCATGAGGATGTAGTTTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000096542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016967.2-427s1c1
Sequence:CCGGGCCACGTCTTCCACCAAGAAACTCGAGTTTCTTGGTGGAAGACGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000096540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016967.2-441s1c1
Sequence:CCGGCAAGAAAGACAAGAAGCAGATCTCGAGATCTGCTTCTTGTCTTTCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016967.2-1279s21c1
Sequence:CCGGACCGAAGCAATGGGAGCATTTCTCGAGAAATGCTCCCATTGCTTCGGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016967.2-1326s21c1
Sequence:CCGGCAGAACCTGGTTGACTCTTTGCTCGAGCAAAGAGTCAACCAGGTTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???