EMAIL THIS PAGE TO A FRIEND

OLR1

oxidized low density lipoprotein (lectin-like) receptor 1

95 Gene Product Result for
Synonyms: CLEC8A LOX1 LOXIN SCARE1 SLOX1
UniProtKB ID: P78380, A8K7V9, B4DI48, G3V1I4, Q2PP00, Q7Z484
Gene ID:
Human(4973) Summary: This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
Mouse(108078) oxidized low density lipoprotein (lectin-like) receptor 1
Rat(140914) oxidized low density lipoprotein (lectin-like) receptor 1
dog(486694) oxidized low density lipoprotein (lectin-like) receptor 1
domestic cat(101086238) oxidized low density lipoprotein (lectin-like) receptor 1
cow(281368) oxidized low density lipoprotein (lectin-like) receptor 1
naked mole-rat(101710182) oxidized low density lipoprotein (lectin-like) receptor 1
domestic guinea pig(100725301) oxidized low density lipoprotein (lectin-like) receptor 1
sheep(101117918) oxidized low density lipoprotein (lectin-like) receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002543 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044311 MISSION® esiRNA esiRNA human OLR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002543 Rosetta Predictions human pricing
NM_133306 Rosetta Predictions rat pricing
NM_138648 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016335 predicted 252
2 SASI_Hs01_00016336 predicted 927
3 SASI_Hs01_00016337 predicted 322
4 SASI_Hs01_00016338 predicted 684
5 SASI_Hs01_00016339 predicted 677
6 SASI_Hs01_00016340 predicted 977
7 SASI_Hs01_00016341 predicted 914
8 SASI_Hs01_00016342 predicted 486
9 SASI_Hs01_00016343 predicted 929
10 SASI_Hs01_00016344 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106751 predicted 911
2 SASI_Rn01_00106752 predicted 307
3 SASI_Rn01_00106753 predicted 559
4 SASI_Rn01_00106754 predicted 885
5 SASI_Rn01_00106755 predicted 1161
6 SASI_Rn01_00106757 predicted 698
7 SASI_Rn01_00106758 predicted 531
8 SASI_Rn01_00106759 predicted 224
9 SASI_Rn01_00106760 predicted 1128
10 SASI_Rn02_00267601 predicted 873
11 SASI_Rn01_00106756 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118143 predicted 841
2 SASI_Mm01_00118144 predicted 234
3 SASI_Mm02_00339698 predicted 877
4 SASI_Mm01_00118146 predicted 266
5 SASI_Mm02_00339699 predicted 1196
6 SASI_Mm01_00118147 predicted 1117
7 SASI_Mm01_00118148 predicted 714
8 SASI_Mm01_00118149 predicted 972
9 SASI_Mm01_00118151 predicted 851
10 SASI_Mm01_00118145 predicted 888
11 SASI_Mm01_00118150 predicted 1104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138648
OLR1 MISSION shRNA Bacterial Glycerol Stock
oxidized low density lipoprotein (lectin-like) receptor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138648.2-767s21c1
Sequence:CCGGCAAGACTGGCTCTGGCATAAACTCGAGTTTATGCCAGAGCCAGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138648.2-660s21c1
Sequence:CCGGCCTTGAAGCTGAACGAGAAATCTCGAGATTTCTCGTTCAGCTTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138648.2-385s21c1
Sequence:CCGGCCAGAAGCTGAACGAGAAATCCTCGAGGATTTCTCGTTCAGCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138648.2-1570s21c1
Sequence:CCGGGCAAAGCTCGTCCGAGAAATACTCGAGTATTTCTCGGACGAGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138648.1-1841s1c1
Sequence:CCGGGCTATGTAGATGTGAAGAATTCTCGAGAATTCTTCACATCTACATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-226s1c1
Sequence:CCGGGCCAGGTATCTGACCTCTTAACTCGAGTTAAGAGGTCAGATACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-918s1c1
Sequence:CCGGCCGTTCTGGATTGGATTGCATCTCGAGATGCAATCCAATCCAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-109s1c1
Sequence:CCGGAGAAGCCTAAAGGTCTGCATTCTCGAGAATGCAGACCTTTAGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-1022s1c1
Sequence:CCGGACAGCTATATTCATCAGGCAACTCGAGTTGCCTGATGAATATAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138648
OLR1 MISSION shRNA shRNA Plasmid DNA
oxidized low density lipoprotein (lectin-like) receptor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138648.2-767s21c1
Sequence:CCGGCAAGACTGGCTCTGGCATAAACTCGAGTTTATGCCAGAGCCAGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138648.2-660s21c1
Sequence:CCGGCCTTGAAGCTGAACGAGAAATCTCGAGATTTCTCGTTCAGCTTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138648.2-385s21c1
Sequence:CCGGCCAGAAGCTGAACGAGAAATCCTCGAGGATTTCTCGTTCAGCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138648.2-1570s21c1
Sequence:CCGGGCAAAGCTCGTCCGAGAAATACTCGAGTATTTCTCGGACGAGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138648.1-1841s1c1
Sequence:CCGGGCTATGTAGATGTGAAGAATTCTCGAGAATTCTTCACATCTACATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-226s1c1
Sequence:CCGGGCCAGGTATCTGACCTCTTAACTCGAGTTAAGAGGTCAGATACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-918s1c1
Sequence:CCGGCCGTTCTGGATTGGATTGCATCTCGAGATGCAATCCAATCCAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-109s1c1
Sequence:CCGGAGAAGCCTAAAGGTCTGCATTCTCGAGAATGCAGACCTTTAGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-1022s1c1
Sequence:CCGGACAGCTATATTCATCAGGCAACTCGAGTTGCCTGATGAATATAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138648
OLR1 MISSION shRNA Lentiviral Transduction Particles
oxidized low density lipoprotein (lectin-like) receptor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138648.2-767s21c1
Sequence:CCGGCAAGACTGGCTCTGGCATAAACTCGAGTTTATGCCAGAGCCAGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138648.2-660s21c1
Sequence:CCGGCCTTGAAGCTGAACGAGAAATCTCGAGATTTCTCGTTCAGCTTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138648.2-385s21c1
Sequence:CCGGCCAGAAGCTGAACGAGAAATCCTCGAGGATTTCTCGTTCAGCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138648.2-1570s21c1
Sequence:CCGGGCAAAGCTCGTCCGAGAAATACTCGAGTATTTCTCGGACGAGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138648.1-1841s1c1
Sequence:CCGGGCTATGTAGATGTGAAGAATTCTCGAGAATTCTTCACATCTACATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-226s1c1
Sequence:CCGGGCCAGGTATCTGACCTCTTAACTCGAGTTAAGAGGTCAGATACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-918s1c1
Sequence:CCGGCCGTTCTGGATTGGATTGCATCTCGAGATGCAATCCAATCCAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-109s1c1
Sequence:CCGGAGAAGCCTAAAGGTCTGCATTCTCGAGAATGCAGACCTTTAGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138648.1-1022s1c1
Sequence:CCGGACAGCTATATTCATCAGGCAACTCGAGTTGCCTGATGAATATAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002543
OLR1 MISSION shRNA Bacterial Glycerol Stock
oxidized low density lipoprotein (lectin-like) receptor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002543.3-1381s21c1
Sequence:CCGGGGACAGAGGCCATTCCGAAATCTCGAGATTTCGGAATGGCCTCTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002543.3-1115s21c1
Sequence:CCGGGATTCTAGCTACCTGTATTATCTCGAGATAATACAGGTAGCTAGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-389s1c1
Sequence:CCGGGCTCGGAAGCTGAATGAGAAACTCGAGTTTCTCATTCAGCTTCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-841s1c1
Sequence:CCGGCTTCAGTATATGTCAGAAGAACTCGAGTTCTTCTGACATATACTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-275s1c1
Sequence:CCGGGCAAACCTAACTCACCAGAAACTCGAGTTTCTGGTGAGTTAGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-564s1c1
Sequence:CCGGGCCAAGAGAAGTGCTTGTCTTCTCGAGAAGACAAGCACTTCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-199s1c1
Sequence:CCGGCCTGGGATTAGTAGTGACCATCTCGAGATGGTCACTACTAATCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002543
OLR1 MISSION shRNA shRNA Plasmid DNA
oxidized low density lipoprotein (lectin-like) receptor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002543.3-1381s21c1
Sequence:CCGGGGACAGAGGCCATTCCGAAATCTCGAGATTTCGGAATGGCCTCTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002543.3-1115s21c1
Sequence:CCGGGATTCTAGCTACCTGTATTATCTCGAGATAATACAGGTAGCTAGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-389s1c1
Sequence:CCGGGCTCGGAAGCTGAATGAGAAACTCGAGTTTCTCATTCAGCTTCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-841s1c1
Sequence:CCGGCTTCAGTATATGTCAGAAGAACTCGAGTTCTTCTGACATATACTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-275s1c1
Sequence:CCGGGCAAACCTAACTCACCAGAAACTCGAGTTTCTGGTGAGTTAGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-564s1c1
Sequence:CCGGGCCAAGAGAAGTGCTTGTCTTCTCGAGAAGACAAGCACTTCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-199s1c1
Sequence:CCGGCCTGGGATTAGTAGTGACCATCTCGAGATGGTCACTACTAATCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002543
OLR1 MISSION shRNA Lentiviral Transduction Particles
oxidized low density lipoprotein (lectin-like) receptor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002543.3-1381s21c1
Sequence:CCGGGGACAGAGGCCATTCCGAAATCTCGAGATTTCGGAATGGCCTCTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002543.3-1115s21c1
Sequence:CCGGGATTCTAGCTACCTGTATTATCTCGAGATAATACAGGTAGCTAGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-389s1c1
Sequence:CCGGGCTCGGAAGCTGAATGAGAAACTCGAGTTTCTCATTCAGCTTCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-841s1c1
Sequence:CCGGCTTCAGTATATGTCAGAAGAACTCGAGTTCTTCTGACATATACTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-275s1c1
Sequence:CCGGGCAAACCTAACTCACCAGAAACTCGAGTTTCTGGTGAGTTAGGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-564s1c1
Sequence:CCGGGCCAAGAGAAGTGCTTGTCTTCTCGAGAAGACAAGCACTTCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002543.2-199s1c1
Sequence:CCGGCCTGGGATTAGTAGTGACCATCTCGAGATGGTCACTACTAATCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)