EMAIL THIS PAGE TO A FRIEND

OMD

osteomodulin

49 Gene Product Result for
Synonyms: OSAD SLRR2C
UniProtKB ID: Q99983, Q5TBF4
Gene ID:
Mouse(27047) osteomodulin
Rat(83717) osteomodulin
fruit fly(41674) oocyte maintenance defects
chicken(101667445) osteomodulin
chicken(101747586) osteomodulin
cow(280885) osteomodulin
dog(610693) osteomodulin
Zebrafish(557913) osteomodulin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
APREST94325 PrEST Antigen OMD Prestige Antigens Powered by Atlas Antibodies human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005014 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012050 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012050 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012050 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005014 Rosetta Predictions human pricing
NM_031817 Rosetta Predictions rat pricing
NM_012050 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096154 predicted 794
2 SASI_Hs01_00096155 predicted 856
3 SASI_Hs01_00096157 predicted 1482
4 SASI_Hs02_00338783 predicted 1325
5 SASI_Hs01_00096160 predicted 1394
6 SASI_Hs01_00096161 predicted 1339
7 SASI_Hs01_00096162 predicted 1635
8 SASI_Hs01_00096163 predicted 1165
9 SASI_Hs02_00338784 predicted 1638
10 SASI_Hs02_00338785 predicted 574
11 SASI_Hs01_00096156 predicted 1444
12 SASI_Hs01_00096158 predicted 668
13 SASI_Hs01_00096159 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116474 predicted 724
2 SASI_Rn01_00116475 predicted 721
3 SASI_Rn01_00116476 predicted 309
4 SASI_Rn01_00116477 predicted 463
5 SASI_Rn01_00116478 predicted 227
6 SASI_Rn01_00116479 predicted 567
7 SASI_Rn02_00265288 predicted 921
8 SASI_Rn01_00116481 predicted 289
9 SASI_Rn01_00116482 predicted 675
10 SASI_Rn01_00116483 predicted 808
11 SASI_Rn01_00116480 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102214 predicted 1474
2 SASI_Mm01_00102215 predicted 961
3 SASI_Mm01_00102216 predicted 1062
4 SASI_Mm01_00102217 predicted 670
5 SASI_Mm01_00102218 predicted 1108
6 SASI_Mm01_00102219 predicted 1286
7 SASI_Mm01_00102220 predicted 465
8 SASI_Mm01_00102221 predicted 540
9 SASI_Mm01_00102222 predicted 504
10 SASI_Mm01_00102223 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005014
OMD MISSION shRNA Bacterial Glycerol Stock
osteomodulin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-1325s1c1
Sequence:CCGGGAAGGGCACTTTGACCTTCATCTCGAGATGAAGGTCAAAGTGCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-317s1c1
Sequence:CCGGCCATCATCAATGTACTGTGATCTCGAGATCACAGTACATTGATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-144s1c1
Sequence:CCGGGAGTCAAAGTACATTGCCAATCTCGAGATTGGCAATGTACTTTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005014.1-1901s1c1
Sequence:CCGGCTCACCACATAGCACATAGAACTCGAGTTCTATGTGCTATGTGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005014.1-1965s1c1
Sequence:CCGGCAAGGCATACAGATTCACAAACTCGAGTTTGTGAATCTGTATGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-901s1c1
Sequence:CCGGCAAACTACAAGACATCCCATACTCGAGTATGGGATGTCTTGTAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-666s1c1
Sequence:CCGGCCATGCTTGATCTCTGTTATACTCGAGTATAACAGAGATCAAGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-200s1c1
Sequence:CCGGGAGCCAGATGATGATTACCAACTCGAGTTGGTAATCATCATCTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-1274s1c1
Sequence:CCGGGATCACGATGATCCTGACAATCTCGAGATTGTCAGGATCATCGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005014.1-1964s1c1
Sequence:CCGGCCAAGGCATACAGATTCACAACTCGAGTTGTGAATCTGTATGCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005014
OMD MISSION shRNA shRNA Plasmid DNA
osteomodulin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-1325s1c1
Sequence:CCGGGAAGGGCACTTTGACCTTCATCTCGAGATGAAGGTCAAAGTGCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-317s1c1
Sequence:CCGGCCATCATCAATGTACTGTGATCTCGAGATCACAGTACATTGATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-144s1c1
Sequence:CCGGGAGTCAAAGTACATTGCCAATCTCGAGATTGGCAATGTACTTTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005014.1-1901s1c1
Sequence:CCGGCTCACCACATAGCACATAGAACTCGAGTTCTATGTGCTATGTGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005014.1-1965s1c1
Sequence:CCGGCAAGGCATACAGATTCACAAACTCGAGTTTGTGAATCTGTATGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-901s1c1
Sequence:CCGGCAAACTACAAGACATCCCATACTCGAGTATGGGATGTCTTGTAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-666s1c1
Sequence:CCGGCCATGCTTGATCTCTGTTATACTCGAGTATAACAGAGATCAAGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-200s1c1
Sequence:CCGGGAGCCAGATGATGATTACCAACTCGAGTTGGTAATCATCATCTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-1274s1c1
Sequence:CCGGGATCACGATGATCCTGACAATCTCGAGATTGTCAGGATCATCGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005014.1-1964s1c1
Sequence:CCGGCCAAGGCATACAGATTCACAACTCGAGTTGTGAATCTGTATGCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005014
OMD MISSION shRNA Lentiviral Transduction Particles
osteomodulin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-1325s1c1
Sequence:CCGGGAAGGGCACTTTGACCTTCATCTCGAGATGAAGGTCAAAGTGCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-317s1c1
Sequence:CCGGCCATCATCAATGTACTGTGATCTCGAGATCACAGTACATTGATGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-144s1c1
Sequence:CCGGGAGTCAAAGTACATTGCCAATCTCGAGATTGGCAATGTACTTTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005014.1-1901s1c1
Sequence:CCGGCTCACCACATAGCACATAGAACTCGAGTTCTATGTGCTATGTGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005014.1-1965s1c1
Sequence:CCGGCAAGGCATACAGATTCACAAACTCGAGTTTGTGAATCTGTATGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-901s1c1
Sequence:CCGGCAAACTACAAGACATCCCATACTCGAGTATGGGATGTCTTGTAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-666s1c1
Sequence:CCGGCCATGCTTGATCTCTGTTATACTCGAGTATAACAGAGATCAAGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-200s1c1
Sequence:CCGGGAGCCAGATGATGATTACCAACTCGAGTTGGTAATCATCATCTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005014.1-1274s1c1
Sequence:CCGGGATCACGATGATCCTGACAATCTCGAGATTGTCAGGATCATCGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005014.1-1964s1c1
Sequence:CCGGCCAAGGCATACAGATTCACAACTCGAGTTGTGAATCTGTATGCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012050
VALIDATED
OMD MISSION shRNA Bacterial Glycerol Stock
osteomodulin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012050.1-1547s1c1
Sequence:CCGGGCCTCCATAAAGCCTTACTAACTCGAGTTAGTAAGGCTTTATGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-316s21c1
Sequence:CCGGGCCAATATGAAGCTTACCGATCTCGAGATCGGTAAGCTTCATATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-1364s21c1
Sequence:CCGGCGGTGAAACAATTCAACTGAACTCGAGTTCAGTTGAATTGTTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_012050.1-1369s1c1
Sequence:CCGGCGGTGAAACAATTCAACTGAACTCGAGTTCAGTTGAATTGTTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012050.1-321s1c1
Sequence:CCGGGCCAATATGAAGCTTACCGATCTCGAGATCGGTAAGCTTCATATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012050.1-956s1c1
Sequence:CCGGCCTTCATCACTTATGTATCTACTCGAGTAGATACATAAGTGATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012050.1-1324s1c1
Sequence:CCGGCCCTCGTATACACAGTATTTACTCGAGTAAATACTGTGTATACGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-951s21c1
Sequence:CCGGCCTTCATCACTTATGTATCTACTCGAGTAGATACATAAGTGATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012050.2-1542s21c1
Sequence:CCGGGCCTCCATAAAGCCTTACTAACTCGAGTTAGTAAGGCTTTATGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-1319s21c1
Sequence:CCGGCCCTCGTATACACAGTATTTACTCGAGTAAATACTGTGTATACGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012050
VALIDATED
OMD MISSION shRNA shRNA Plasmid DNA
osteomodulin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012050.1-1547s1c1
Sequence:CCGGGCCTCCATAAAGCCTTACTAACTCGAGTTAGTAAGGCTTTATGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-316s21c1
Sequence:CCGGGCCAATATGAAGCTTACCGATCTCGAGATCGGTAAGCTTCATATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-1364s21c1
Sequence:CCGGCGGTGAAACAATTCAACTGAACTCGAGTTCAGTTGAATTGTTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_012050.1-1369s1c1
Sequence:CCGGCGGTGAAACAATTCAACTGAACTCGAGTTCAGTTGAATTGTTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012050.1-321s1c1
Sequence:CCGGGCCAATATGAAGCTTACCGATCTCGAGATCGGTAAGCTTCATATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012050.1-956s1c1
Sequence:CCGGCCTTCATCACTTATGTATCTACTCGAGTAGATACATAAGTGATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012050.1-1324s1c1
Sequence:CCGGCCCTCGTATACACAGTATTTACTCGAGTAAATACTGTGTATACGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-951s21c1
Sequence:CCGGCCTTCATCACTTATGTATCTACTCGAGTAGATACATAAGTGATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012050.2-1542s21c1
Sequence:CCGGGCCTCCATAAAGCCTTACTAACTCGAGTTAGTAAGGCTTTATGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-1319s21c1
Sequence:CCGGCCCTCGTATACACAGTATTTACTCGAGTAAATACTGTGTATACGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012050
VALIDATED
OMD MISSION shRNA Lentiviral Transduction Particles
osteomodulin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012050.1-1547s1c1
Sequence:CCGGGCCTCCATAAAGCCTTACTAACTCGAGTTAGTAAGGCTTTATGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-316s21c1
Sequence:CCGGGCCAATATGAAGCTTACCGATCTCGAGATCGGTAAGCTTCATATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-1364s21c1
Sequence:CCGGCGGTGAAACAATTCAACTGAACTCGAGTTCAGTTGAATTGTTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_012050.1-1369s1c1
Sequence:CCGGCGGTGAAACAATTCAACTGAACTCGAGTTCAGTTGAATTGTTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012050.1-321s1c1
Sequence:CCGGGCCAATATGAAGCTTACCGATCTCGAGATCGGTAAGCTTCATATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012050.1-956s1c1
Sequence:CCGGCCTTCATCACTTATGTATCTACTCGAGTAGATACATAAGTGATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012050.1-1324s1c1
Sequence:CCGGCCCTCGTATACACAGTATTTACTCGAGTAAATACTGTGTATACGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-951s21c1
Sequence:CCGGCCTTCATCACTTATGTATCTACTCGAGTAGATACATAAGTGATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012050.2-1542s21c1
Sequence:CCGGGCCTCCATAAAGCCTTACTAACTCGAGTTAGTAAGGCTTTATGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012050.2-1319s21c1
Sequence:CCGGCCCTCGTATACACAGTATTTACTCGAGTAAATACTGTGTATACGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)