EMAIL THIS PAGE TO A FRIEND

OMP

olfactory marker protein

44 Gene Product Result for
UniProtKB ID: P47874, Q562G2
Gene ID:
Human(4975) Summary: Olfactory marker protein is uniquely associated with the mature olfactory receptor neurons in many vertebrate species from fish to man. The OMP gene structure and protein sequence are highly conserved between mouse, rat and human. Results of the mouse knockout studies show that OMP-null mice are compromised in their ability to respond to odor stimuli, and that OMP represents a novel modulatory component of the odor detection/signal transduction cascade. [provided by RefSeq, Jul 2008]
Mouse(18378) olfactory marker protein
Rat(24612) olfactory marker protein
chicken(101749160) olfactory marker protein
cow(613648) olfactory marker protein
domestic cat(101087865) olfactory marker protein
dog(607920) olfactory marker protein
chicken(101668769) olfactory marker protein
sheep(101113008) olfactory marker protein
naked mole-rat(101711172) olfactory marker protein
domestic guinea pig(100715226) olfactory marker protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011010 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011010 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011010 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006189 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022521 MISSION® esiRNA esiRNA targeting mouse Omp (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006189 Rosetta Predictions human pricing
NM_012616 Rosetta Predictions rat pricing
NM_011010 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150685 predicted 230
2 SASI_Hs01_00150686 predicted 198
3 SASI_Hs01_00150687 predicted 245
4 SASI_Hs01_00150688 predicted 214
5 SASI_Hs01_00150689 predicted 245
6 SASI_Hs01_00150690 predicted 457
7 SASI_Hs01_00150691 predicted 190
8 SASI_Hs01_00150692 predicted 138
9 SASI_Hs01_00150693 predicted 305
10 SASI_Hs01_00150694 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119196 predicted 219
2 SASI_Rn01_00119197 predicted 206
3 SASI_Rn01_00119198 predicted 207
4 SASI_Rn01_00119199 predicted 315
5 SASI_Rn01_00119200 predicted 200
6 SASI_Rn01_00119201 predicted 285
7 SASI_Rn01_00119202 predicted 321
8 SASI_Rn01_00119203 predicted 234
9 SASI_Rn01_00119204 predicted 232
10 SASI_Rn01_00119205 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033058 predicted 724
2 SASI_Mm01_00033059 predicted 423
3 SASI_Mm02_00319731 predicted 1009
4 SASI_Mm01_00033060 predicted 686
5 SASI_Mm01_00033061 predicted 970
6 SASI_Mm01_00033062 predicted 483
7 SASI_Mm01_00033063 predicted 672
8 SASI_Mm01_00033064 predicted 870
9 SASI_Mm01_00033065 predicted 259
10 SASI_Mm01_00033066 predicted 817
11 SASI_Mm01_00033067 predicted 204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011010
OMP MISSION shRNA Bacterial Glycerol Stock
olfactory marker protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011010.2-182s21c1
Sequence:CCGGCGTCTACCGCCTCGATTTCATCTCGAGATGAAATCGAGGCGGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011010.2-431s1c1
Sequence:CCGGGATCCGCAAGGTCATGTATTTCTCGAGAAATACATGACCTTGCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011010.2-223s21c1
Sequence:CCGGTCGATCACTGGAACGTGGTTCCTCGAGGAACCACGTTCCAGTGATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011010.2-431s21c1
Sequence:CCGGGATCCGCAAGGTCATGTATTTCTCGAGAAATACATGACCTTGCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011010.2-1134s21c1
Sequence:CCGGTCTAGCCACCCACGCTCATATCTCGAGATATGAGCGTGGGTGGCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011010
OMP MISSION shRNA shRNA Plasmid DNA
olfactory marker protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011010.2-182s21c1
Sequence:CCGGCGTCTACCGCCTCGATTTCATCTCGAGATGAAATCGAGGCGGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011010.2-431s1c1
Sequence:CCGGGATCCGCAAGGTCATGTATTTCTCGAGAAATACATGACCTTGCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011010.2-223s21c1
Sequence:CCGGTCGATCACTGGAACGTGGTTCCTCGAGGAACCACGTTCCAGTGATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011010.2-431s21c1
Sequence:CCGGGATCCGCAAGGTCATGTATTTCTCGAGAAATACATGACCTTGCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011010.2-1134s21c1
Sequence:CCGGTCTAGCCACCCACGCTCATATCTCGAGATATGAGCGTGGGTGGCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011010
OMP MISSION shRNA Lentiviral Transduction Particles
olfactory marker protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011010.2-182s21c1
Sequence:CCGGCGTCTACCGCCTCGATTTCATCTCGAGATGAAATCGAGGCGGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011010.2-431s1c1
Sequence:CCGGGATCCGCAAGGTCATGTATTTCTCGAGAAATACATGACCTTGCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011010.2-223s21c1
Sequence:CCGGTCGATCACTGGAACGTGGTTCCTCGAGGAACCACGTTCCAGTGATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011010.2-431s21c1
Sequence:CCGGGATCCGCAAGGTCATGTATTTCTCGAGAAATACATGACCTTGCGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011010.2-1134s21c1
Sequence:CCGGTCTAGCCACCCACGCTCATATCTCGAGATATGAGCGTGGGTGGCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006189
OMP MISSION shRNA Bacterial Glycerol Stock
olfactory marker protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-329s1c1
Sequence:CCGGAGGACTCGGATGCCATAGATTCTCGAGAATCTATGGCATCCGAGTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-187s1c1
Sequence:CCGGCTACAGTTCGAGCGCTGGAATCTCGAGATTCCAGCGCTCGAACTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-342s1c1
Sequence:CCGGCATAGATTGGAATGAGGCCGACTCGAGTCGGCCTCATTCCAATCTATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-146s1c1
Sequence:CCGGCGGAGTCTGTGTACCGCCTCACTCGAGTGAGGCGGTACACAGACTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-78s1c1
Sequence:CCGGGCTACGCGTGGAGAGCCTGAACTCGAGTTCAGGCTCTCCACGCGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006189
OMP MISSION shRNA shRNA Plasmid DNA
olfactory marker protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-329s1c1
Sequence:CCGGAGGACTCGGATGCCATAGATTCTCGAGAATCTATGGCATCCGAGTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-187s1c1
Sequence:CCGGCTACAGTTCGAGCGCTGGAATCTCGAGATTCCAGCGCTCGAACTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-342s1c1
Sequence:CCGGCATAGATTGGAATGAGGCCGACTCGAGTCGGCCTCATTCCAATCTATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-146s1c1
Sequence:CCGGCGGAGTCTGTGTACCGCCTCACTCGAGTGAGGCGGTACACAGACTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-78s1c1
Sequence:CCGGGCTACGCGTGGAGAGCCTGAACTCGAGTTCAGGCTCTCCACGCGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006189
OMP MISSION shRNA Lentiviral Transduction Particles
olfactory marker protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-329s1c1
Sequence:CCGGAGGACTCGGATGCCATAGATTCTCGAGAATCTATGGCATCCGAGTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-187s1c1
Sequence:CCGGCTACAGTTCGAGCGCTGGAATCTCGAGATTCCAGCGCTCGAACTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-342s1c1
Sequence:CCGGCATAGATTGGAATGAGGCCGACTCGAGTCGGCCTCATTCCAATCTATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-146s1c1
Sequence:CCGGCGGAGTCTGTGTACCGCCTCACTCGAGTGAGGCGGTACACAGACTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006189.1-78s1c1
Sequence:CCGGGCTACGCGTGGAGAGCCTGAACTCGAGTTCAGGCTCTCCACGCGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)