EMAIL THIS PAGE TO A FRIEND

ONECUT1

one cut homeobox 1

72 Gene Product Result for
Synonyms: HNF-6 HNF6 HNF6A
UniProtKB ID: Q9UBC0, B2RTV4, Q99744, Q9UMR6
Gene ID:
Human(3175) Summary: This gene encodes a member of the Cut homeobox family of transcription factors. Expression of the encoded protein is enriched in the liver, where it stimulates transcription of liver-expressed genes, and antagonizes glucocorticoid-stimulated gene transcription. This gene may influence a variety of cellular processes including glucose metabolism, cell cycle regulation, and it may also be associated with cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(15379) one cut domain, family member 1
Rat(25231) one cut homeobox 1
Zebrafish(393545) one cut domain, family member 1
dog(487558) one cut homeobox 1
domestic cat(101092522) one cut homeobox 1
cow(503584) one cut homeobox 1
chicken(100857312) one cut homeobox 1
sheep(101102397) one cut homeobox 1
domestic guinea pig(100723740) one cut homeobox 1
naked mole-rat(101725703) one cut homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101679 Anti-ONECUT1 (ab1) antibody produced in rabbit affinity isolated antibody guinea pig, canine, rabbit, rat, human, mouse
western blot pricing
SAB2101680 Anti-ONECUT1 (ab2) antibody produced in rabbit affinity isolated antibody canine, mouse, zebrafish, rabbit, rat, horse, human
immunohistochemistry, western blot pricing
HPA003457 Anti-ONECUT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB2106240 Anti-ONECUT1 antibody produced in rabbit affinity isolated antibody horse, mouse, rabbit, guinea pig, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004498 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004498 Rosetta Predictions human pricing
NM_022671 Rosetta Predictions rat pricing
NM_008262 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096024 predicted 1307
2 SASI_Hs01_00096025 predicted 984
3 SASI_Hs02_00337750 predicted 1290
4 SASI_Hs01_00096027 predicted 1316
5 SASI_Hs01_00096028 predicted 1290
6 SASI_Hs01_00096030 predicted 1316
7 SASI_Hs01_00096031 predicted 970
8 SASI_Hs02_00337751 predicted 1320
9 SASI_Hs01_00096032 predicted 1320
10 SASI_Hs01_00096033 predicted 968
11 SASI_Hs01_00096026 predicted 1226
12 SASI_Hs01_00096029 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032460 predicted 1752
2 SASI_Rn01_00032461 predicted 1430
3 SASI_Rn01_00032462 predicted 1130
4 SASI_Rn01_00032463 predicted 1633
5 SASI_Rn01_00032464 predicted 1712
6 SASI_Rn02_00263441 predicted 1111
7 SASI_Rn01_00032465 predicted 1790
8 SASI_Rn01_00032466 predicted 1085
9 SASI_Rn01_00032467 predicted 965
10 SASI_Rn02_00263442 predicted 1614
11 SASI_Rn01_00032468 predicted 1724
12 SASI_Rn01_00032469 predicted 1925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051654 predicted 1562
2 SASI_Mm01_00051655 predicted 1228
3 SASI_Mm01_00051657 predicted 1265
4 SASI_Mm01_00051656 predicted 1473
5 SASI_Mm01_00051658 predicted 1557
6 SASI_Mm01_00051659 predicted 1282
7 SASI_Mm01_00051660 predicted 1267
8 SASI_Mm01_00051662 predicted 1126
9 SASI_Mm01_00051663 predicted 1561
10 SASI_Mm02_00313480 predicted 1221
11 SASI_Mm01_00051661 predicted 1358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008262
ONECUT1 MISSION shRNA Bacterial Glycerol Stock
one cut homeobox 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1605s1c1
Sequence:CCGGCGTCCAAAGAATTACAAATCACTCGAGTGATTTGTAATTCTTTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-675s1c1
Sequence:CCGGCCACCACCTACACTACCTTAACTCGAGTTAAGGTAGTGTAGGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1212s1c1
Sequence:CCGGAGGTCAGCAATGGAAGTAATTCTCGAGAATTACTTCCATTGCTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1602s1c1
Sequence:CCGGGTCCGTCCAAAGAATTACAAACTCGAGTTTGTAATTCTTTGGACGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1210s1c1
Sequence:CCGGGCAGGTCAGCAATGGAAGTAACTCGAGTTACTTCCATTGCTGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-933s21c1
Sequence:CCGGGTCTGGGCAGCATTCACAACTCTCGAGAGTTGTGAATGCTGCCCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-1275s21c1
Sequence:CCGGGTATCACCACCGAGCTCAAACCTCGAGGTTTGAGCTCGGTGGTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-735s21c1
Sequence:CCGGACAAGTTCCCTCACCATCATCCTCGAGGATGATGGTGAGGGAACTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-1128s21c1
Sequence:CCGGATCCTCATGCCCACCTGAATGCTCGAGCATTCAGGTGGGCATGAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008262
ONECUT1 MISSION shRNA shRNA Plasmid DNA
one cut homeobox 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1605s1c1
Sequence:CCGGCGTCCAAAGAATTACAAATCACTCGAGTGATTTGTAATTCTTTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-675s1c1
Sequence:CCGGCCACCACCTACACTACCTTAACTCGAGTTAAGGTAGTGTAGGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1212s1c1
Sequence:CCGGAGGTCAGCAATGGAAGTAATTCTCGAGAATTACTTCCATTGCTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1602s1c1
Sequence:CCGGGTCCGTCCAAAGAATTACAAACTCGAGTTTGTAATTCTTTGGACGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1210s1c1
Sequence:CCGGGCAGGTCAGCAATGGAAGTAACTCGAGTTACTTCCATTGCTGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-933s21c1
Sequence:CCGGGTCTGGGCAGCATTCACAACTCTCGAGAGTTGTGAATGCTGCCCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-1275s21c1
Sequence:CCGGGTATCACCACCGAGCTCAAACCTCGAGGTTTGAGCTCGGTGGTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-735s21c1
Sequence:CCGGACAAGTTCCCTCACCATCATCCTCGAGGATGATGGTGAGGGAACTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-1128s21c1
Sequence:CCGGATCCTCATGCCCACCTGAATGCTCGAGCATTCAGGTGGGCATGAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008262
ONECUT1 MISSION shRNA Lentiviral Transduction Particles
one cut homeobox 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1605s1c1
Sequence:CCGGCGTCCAAAGAATTACAAATCACTCGAGTGATTTGTAATTCTTTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-675s1c1
Sequence:CCGGCCACCACCTACACTACCTTAACTCGAGTTAAGGTAGTGTAGGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1212s1c1
Sequence:CCGGAGGTCAGCAATGGAAGTAATTCTCGAGAATTACTTCCATTGCTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1602s1c1
Sequence:CCGGGTCCGTCCAAAGAATTACAAACTCGAGTTTGTAATTCTTTGGACGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008262.2-1210s1c1
Sequence:CCGGGCAGGTCAGCAATGGAAGTAACTCGAGTTACTTCCATTGCTGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-933s21c1
Sequence:CCGGGTCTGGGCAGCATTCACAACTCTCGAGAGTTGTGAATGCTGCCCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-1275s21c1
Sequence:CCGGGTATCACCACCGAGCTCAAACCTCGAGGTTTGAGCTCGGTGGTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-735s21c1
Sequence:CCGGACAAGTTCCCTCACCATCATCCTCGAGGATGATGGTGAGGGAACTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008262.3-1128s21c1
Sequence:CCGGATCCTCATGCCCACCTGAATGCTCGAGCATTCAGGTGGGCATGAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004498
ONECUT1 MISSION shRNA Bacterial Glycerol Stock
one cut homeobox 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004498.1-1596s1c1
Sequence:CCGGCCTCAAGATAGCAGGTTTATACTCGAGTATAAACCTGCTATCTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-1317s1c1
Sequence:CCGGCGTCGAACTCTACATGCAATACTCGAGTATTGCATGTAGAGTTCGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-974s1c1
Sequence:CCGGTGGAAGTAATTCAGGGCAGATCTCGAGATCTGCCCTGAATTACTTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-603s1c1
Sequence:CCGGGCCTCCATGAATAACCTCTATCTCGAGATAGAGGTTATTCATGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-1474s1c1
Sequence:CCGGGCTCCAATTCAGGCAACTCATCTCGAGATGAGTTGCCTGAATTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004498.1-1356s21c1
Sequence:CCGGCCATCCAAAGAATTGCAAATCCTCGAGGATTTGCAATTCTTTGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004498.1-1641s21c1
Sequence:CCGGAGCGTTATTTATAGTCCAAAGCTCGAGCTTTGGACTATAAATAACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004498.1-1677s21c1
Sequence:CCGGCTCACCTGCATTCTGACTTTGCTCGAGCAAAGTCAGAATGCAGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004498.1-1133s21c1
Sequence:CCGGACCCTGGAGCAAACTCAAATCCTCGAGGATTTGAGTTTGCTCCAGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004498
ONECUT1 MISSION shRNA shRNA Plasmid DNA
one cut homeobox 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004498.1-1596s1c1
Sequence:CCGGCCTCAAGATAGCAGGTTTATACTCGAGTATAAACCTGCTATCTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-1317s1c1
Sequence:CCGGCGTCGAACTCTACATGCAATACTCGAGTATTGCATGTAGAGTTCGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-974s1c1
Sequence:CCGGTGGAAGTAATTCAGGGCAGATCTCGAGATCTGCCCTGAATTACTTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-603s1c1
Sequence:CCGGGCCTCCATGAATAACCTCTATCTCGAGATAGAGGTTATTCATGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-1474s1c1
Sequence:CCGGGCTCCAATTCAGGCAACTCATCTCGAGATGAGTTGCCTGAATTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004498.1-1356s21c1
Sequence:CCGGCCATCCAAAGAATTGCAAATCCTCGAGGATTTGCAATTCTTTGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004498.1-1641s21c1
Sequence:CCGGAGCGTTATTTATAGTCCAAAGCTCGAGCTTTGGACTATAAATAACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004498.1-1677s21c1
Sequence:CCGGCTCACCTGCATTCTGACTTTGCTCGAGCAAAGTCAGAATGCAGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004498.1-1133s21c1
Sequence:CCGGACCCTGGAGCAAACTCAAATCCTCGAGGATTTGAGTTTGCTCCAGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004498
ONECUT1 MISSION shRNA Lentiviral Transduction Particles
one cut homeobox 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004498.1-1596s1c1
Sequence:CCGGCCTCAAGATAGCAGGTTTATACTCGAGTATAAACCTGCTATCTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-1317s1c1
Sequence:CCGGCGTCGAACTCTACATGCAATACTCGAGTATTGCATGTAGAGTTCGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-974s1c1
Sequence:CCGGTGGAAGTAATTCAGGGCAGATCTCGAGATCTGCCCTGAATTACTTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-603s1c1
Sequence:CCGGGCCTCCATGAATAACCTCTATCTCGAGATAGAGGTTATTCATGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004498.1-1474s1c1
Sequence:CCGGGCTCCAATTCAGGCAACTCATCTCGAGATGAGTTGCCTGAATTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004498.1-1356s21c1
Sequence:CCGGCCATCCAAAGAATTGCAAATCCTCGAGGATTTGCAATTCTTTGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004498.1-1641s21c1
Sequence:CCGGAGCGTTATTTATAGTCCAAAGCTCGAGCTTTGGACTATAAATAACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004498.1-1677s21c1
Sequence:CCGGCTCACCTGCATTCTGACTTTGCTCGAGCAAAGTCAGAATGCAGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004498.1-1133s21c1
Sequence:CCGGACCCTGGAGCAAACTCAAATCCTCGAGGATTTGAGTTTGCTCCAGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)