EMAIL THIS PAGE TO A FRIEND

ONECUT2

one cut homeobox 2

410 Gene Product Result for
Synonyms: OC-2 OC2
UniProtKB ID: O95948
Gene ID:
Human(9480) Summary: This gene encodes a member of the onecut family of transcription factors, which are characterized by a cut domain and an atypical homeodomain. The protein binds to specific DNA sequences and stimulates expression of target genes, including genes involved in melanocyte and hepatocyte differentiation. [provided by RefSeq, Jul 2008]
Mouse(225631) one cut domain, family member 2
Rat(307376) one cut homeobox 2
naked mole-rat(101713029) one cut homeobox 2
domestic guinea pig(100730754) one cut homeobox 2
sheep(101114994) one cut homeobox 2
chicken(100857974) one cut homeobox 2
domestic cat(101087617) one cut homeobox 2
cow(782542) one cut homeobox 2
Horse(100053967) one cut homeobox 2
dog(483967) one cut homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35750 Anti-ONECUT2 antibody produced in rabbit IgG fraction of antiserum horse, mouse, dog, bovine, rat, rabbit, human, guinea pig
immunohistochemistry, western blot pricing
SAB2101681 Anti-ONECUT2 antibody produced in rabbit affinity isolated antibody human, guinea pig
western blot pricing
SAB2105070 Anti-ONECUT2 antibody produced in rabbit affinity isolated antibody dog, mouse, rabbit, horse, guinea pig, rat, bovine, human
western blot pricing
HPA057058 Anti-ONECUT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004852 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007381 MISSION® esiRNA esiRNA targeting human ONECUT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004852 Rosetta Predictions human pricing
XM_225875 Rosetta Predictions rat pricing
XR_008141 Rosetta Predictions rat pricing
NM_194268 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338445 predicted 1865
2 SASI_Hs02_00338446 predicted 1680
3 SASI_Hs01_00066548 predicted 1350
4 SASI_Hs02_00338447 predicted 1840
5 SASI_Hs01_00066549 predicted 1258
6 SASI_Hs02_00338448 predicted 1642
7 SASI_Hs02_00338449 predicted 1672
8 SASI_Hs02_00338450 predicted 1552
9 SASI_Hs02_00338451 predicted 1772
10 SASI_Hs02_00338452 predicted 1797
11 SASI_Hs01_00066547 predicted 1300
12 SASI_Hs01_00066550 predicted 1256
13 SASI_Hs01_00066551 predicted 1271
14 SASI_Hs01_00066552 predicted 1018
15 SASI_Hs01_00066553 predicted 1288
16 SASI_Hs01_00066554 predicted 1328
17 SASI_Hs01_00066555 predicted 1395
18 SASI_Hs01_00066556 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173954 predicted 2713
2 SASI_Rn01_00173955 predicted 2731
3 SASI_Rn01_00173956 predicted 2752
4 SASI_Rn01_00173957 predicted 2599
5 SASI_Rn01_00173958 predicted 2716
6 SASI_Rn01_00173959 predicted 2936
7 SASI_Rn01_00173960 predicted 2923
8 SASI_Rn01_00173961 predicted 3019
9 SASI_Rn01_00173962 predicted 2928
10 SASI_Rn01_00173963 predicted 3000
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00416317 predicted 1683
2 SASI_Rn02_00416318 predicted 1681
3 SASI_Rn02_00416319 predicted 1703
4 SASI_Rn02_00416320 predicted 1677
5 SASI_Rn02_00416321 predicted 1707
6 SASI_Rn02_00416322 predicted 1677
7 SASI_Rn02_00416323 predicted 1718
8 SASI_Rn02_00416324 predicted 1736
9 SASI_Rn02_00416325 predicted 1508
10 SASI_Rn02_00416326 predicted 1819
11 SASI_Rn01_00158252 predicted 866
12 SASI_Rn01_00158253 predicted 881
13 SASI_Rn01_00158254 predicted 914
14 SASI_Rn01_00158255 predicted 745
15 SASI_Rn01_00158256 predicted 864
16 SASI_Rn01_00158257 predicted 1082
17 SASI_Rn01_00158258 predicted 1075
18 SASI_Rn01_00158259 predicted 1165
19 SASI_Rn01_00158260 predicted 1083
20 SASI_Rn01_00158261 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350599 predicted 1916
2 SASI_Mm02_00350600 predicted 1877
3 SASI_Mm02_00350601 predicted 1881
4 SASI_Mm01_00026305 predicted 1336
5 SASI_Mm01_00026307 predicted 1075
6 SASI_Mm01_00026309 predicted 1255
7 SASI_Mm02_00350602 predicted 1908
8 SASI_Mm01_00026312 predicted 874
9 SASI_Mm01_00026313 predicted 1249
10 SASI_Mm02_00350603 predicted 1880
11 SASI_Mm01_00026306 predicted 1285
12 SASI_Mm01_00026308 predicted 1283
13 SASI_Mm01_00026310 predicted 885
14 SASI_Mm01_00026311 predicted 1243
15 SASI_Mm01_00026314 predicted 918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194268
VALIDATED
ONECUT2 MISSION shRNA Bacterial Glycerol Stock
one cut homeobox 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-643s1c1
Sequence:CCGGCAACCTTTACAGCCCTTACAACTCGAGTTGTAAGGGCTGTAAAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-640s1c1
Sequence:CCGGGAACAACCTTTACAGCCCTTACTCGAGTAAGGGCTGTAAAGGTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-1282s1c1
Sequence:CCGGCAGGAACAACTCGCAGAAGAACTCGAGTTCTTCTGCGAGTTGTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194268.1-1283s1c1
Sequence:CCGGAGGAACAACTCGCAGAAGAAACTCGAGTTTCTTCTGCGAGTTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-1138s1c1
Sequence:CCGGGAATCCCAAACCCTGGAGTAACTCGAGTTACTCCAGGGTTTGGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194268.2-1879s21c1
Sequence:CCGGGCCTTCTTGGAGTGAGTTAATCTCGAGATTAACTCACTCCAAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194268.2-1807s21c1
Sequence:CCGGCGCTGAAAGTTAATCTCTTTGCTCGAGCAAAGAGATTAACTTTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194268
VALIDATED
ONECUT2 MISSION shRNA shRNA Plasmid DNA
one cut homeobox 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-643s1c1
Sequence:CCGGCAACCTTTACAGCCCTTACAACTCGAGTTGTAAGGGCTGTAAAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-640s1c1
Sequence:CCGGGAACAACCTTTACAGCCCTTACTCGAGTAAGGGCTGTAAAGGTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-1282s1c1
Sequence:CCGGCAGGAACAACTCGCAGAAGAACTCGAGTTCTTCTGCGAGTTGTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194268.1-1283s1c1
Sequence:CCGGAGGAACAACTCGCAGAAGAAACTCGAGTTTCTTCTGCGAGTTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-1138s1c1
Sequence:CCGGGAATCCCAAACCCTGGAGTAACTCGAGTTACTCCAGGGTTTGGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194268.2-1879s21c1
Sequence:CCGGGCCTTCTTGGAGTGAGTTAATCTCGAGATTAACTCACTCCAAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194268.2-1807s21c1
Sequence:CCGGCGCTGAAAGTTAATCTCTTTGCTCGAGCAAAGAGATTAACTTTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194268
VALIDATED
ONECUT2 MISSION shRNA Lentiviral Transduction Particles
one cut homeobox 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-643s1c1
Sequence:CCGGCAACCTTTACAGCCCTTACAACTCGAGTTGTAAGGGCTGTAAAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-640s1c1
Sequence:CCGGGAACAACCTTTACAGCCCTTACTCGAGTAAGGGCTGTAAAGGTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-1282s1c1
Sequence:CCGGCAGGAACAACTCGCAGAAGAACTCGAGTTCTTCTGCGAGTTGTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194268.1-1283s1c1
Sequence:CCGGAGGAACAACTCGCAGAAGAAACTCGAGTTTCTTCTGCGAGTTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194268.1-1138s1c1
Sequence:CCGGGAATCCCAAACCCTGGAGTAACTCGAGTTACTCCAGGGTTTGGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194268.2-1879s21c1
Sequence:CCGGGCCTTCTTGGAGTGAGTTAATCTCGAGATTAACTCACTCCAAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194268.2-1807s21c1
Sequence:CCGGCGCTGAAAGTTAATCTCTTTGCTCGAGCAAAGAGATTAACTTTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004852
VALIDATED
ONECUT2 MISSION shRNA Bacterial Glycerol Stock
one cut homeobox 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_004852.1-1345s1c1
Sequence:CCGGCCGAACACTCTTCGCCATCTTCTCGAGAAGATGGCGAAGAGTGTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004852.1-454s1c1
Sequence:CCGGCATGGGCATGAGCAACACCTACTCGAGTAGGTGTTGCTCATGCCCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004852.1-655s1c1
Sequence:CCGGCAACCTCTACAGTCCCTACAACTCGAGTTGTAGGGACTGTAGAGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004852.1-1259s1c1
Sequence:CCGGGCGTGCAAACGCAAAGAGCAACTCGAGTTGCTCTTTGCGTTTGCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004852.1-647s1c1
Sequence:CCGGGCCATGAACAACCTCTACAGTCTCGAGACTGTAGAGGTTGTTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004852.2-11722s21c1
Sequence:CCGGACTGCCAATCAGTGCTATAATCTCGAGATTATAGCACTGATTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004852.2-90s21c1
Sequence:CCGGATGAACCCGGAGCTGACAATGCTCGAGCATTGTCAGCTCCGGGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004852.2-1285s21c1
Sequence:CCGGCAAACAAAGACAGGAACAATTCTCGAGAATTGTTCCTGTCTTTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004852.2-1371s21c1
Sequence:CCGGGAGAACAAACGCCCGTCAAAGCTCGAGCTTTGACGGGCGTTTGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004852.2-1347s21c1
Sequence:CCGGCGAACACTCTTCGCCATCTTCCTCGAGGAAGATGGCGAAGAGTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004852
VALIDATED
ONECUT2 MISSION shRNA shRNA Plasmid DNA
one cut homeobox 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_004852.1-1345s1c1
Sequence:CCGGCCGAACACTCTTCGCCATCTTCTCGAGAAGATGGCGAAGAGTGTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004852.1-454s1c1
Sequence:CCGGCATGGGCATGAGCAACACCTACTCGAGTAGGTGTTGCTCATGCCCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004852.1-655s1c1
Sequence:CCGGCAACCTCTACAGTCCCTACAACTCGAGTTGTAGGGACTGTAGAGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004852.1-1259s1c1
Sequence:CCGGGCGTGCAAACGCAAAGAGCAACTCGAGTTGCTCTTTGCGTTTGCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004852.1-647s1c1
Sequence:CCGGGCCATGAACAACCTCTACAGTCTCGAGACTGTAGAGGTTGTTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004852.2-11722s21c1
Sequence:CCGGACTGCCAATCAGTGCTATAATCTCGAGATTATAGCACTGATTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004852.2-90s21c1
Sequence:CCGGATGAACCCGGAGCTGACAATGCTCGAGCATTGTCAGCTCCGGGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004852.2-1285s21c1
Sequence:CCGGCAAACAAAGACAGGAACAATTCTCGAGAATTGTTCCTGTCTTTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004852.2-1371s21c1
Sequence:CCGGGAGAACAAACGCCCGTCAAAGCTCGAGCTTTGACGGGCGTTTGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004852.2-1347s21c1
Sequence:CCGGCGAACACTCTTCGCCATCTTCCTCGAGGAAGATGGCGAAGAGTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004852
VALIDATED
ONECUT2 MISSION shRNA Lentiviral Transduction Particles
one cut homeobox 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_004852.1-1345s1c1
Sequence:CCGGCCGAACACTCTTCGCCATCTTCTCGAGAAGATGGCGAAGAGTGTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004852.1-454s1c1
Sequence:CCGGCATGGGCATGAGCAACACCTACTCGAGTAGGTGTTGCTCATGCCCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004852.1-655s1c1
Sequence:CCGGCAACCTCTACAGTCCCTACAACTCGAGTTGTAGGGACTGTAGAGGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004852.1-1259s1c1
Sequence:CCGGGCGTGCAAACGCAAAGAGCAACTCGAGTTGCTCTTTGCGTTTGCACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004852.1-647s1c1
Sequence:CCGGGCCATGAACAACCTCTACAGTCTCGAGACTGTAGAGGTTGTTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004852.2-11722s21c1
Sequence:CCGGACTGCCAATCAGTGCTATAATCTCGAGATTATAGCACTGATTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004852.2-90s21c1
Sequence:CCGGATGAACCCGGAGCTGACAATGCTCGAGCATTGTCAGCTCCGGGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004852.2-1285s21c1
Sequence:CCGGCAAACAAAGACAGGAACAATTCTCGAGAATTGTTCCTGTCTTTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004852.2-1371s21c1
Sequence:CCGGGAGAACAAACGCCCGTCAAAGCTCGAGCTTTGACGGGCGTTTGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004852.2-1347s21c1
Sequence:CCGGCGAACACTCTTCGCCATCTTCCTCGAGGAAGATGGCGAAGAGTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)