EMAIL THIS PAGE TO A FRIEND

ONECUT3

one cut homeobox 3

31 Gene Product Result for
Synonyms: OC3
UniProtKB ID: O60422, A8MZM7
Gene ID:
Mouse(246086) one cut domain, family member 3
Rat(366829) one cut domain, family member 3
cow(618065) one cut homeobox 3
dog(612249) one cut homeobox 3
naked mole-rat(101719476) one cut homeobox 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA059936 Anti-ONECUT3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139226 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139226 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139226 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080488 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080488 Rosetta Predictions human pricing
XM_372702 Rosetta Predictions human pricing
NM_139226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315326 predicted 1190
2 SASI_Hs02_00315327 predicted 1169
3 SASI_Hs02_00315328 predicted 1189
4 SASI_Hs02_00315329 predicted 1189
5 SASI_Hs02_00315330 predicted 1197
6 SASI_Hs02_00315331 predicted 1041
7 SASI_Hs02_00315332 predicted 1004
8 SASI_Hs02_00315333 predicted 1018
9 SASI_Hs02_00315334 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295045 predicted 1193
2 SASI_Hs01_00295046 predicted 1179
3 SASI_Hs01_00295047 predicted 1192
4 SASI_Hs01_00295048 predicted 1196
5 SASI_Hs01_00295049 predicted 1200
6 SASI_Hs01_00295050 predicted 1171
7 SASI_Hs01_00295051 predicted 1041
8 SASI_Hs01_00295052 predicted 1350
9 SASI_Hs01_00295053 predicted 1321
10 SASI_Hs01_00295054 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339937 predicted 1371
2 SASI_Mm02_00339938 predicted 2057
3 SASI_Mm02_00339939 predicted 453
4 SASI_Mm02_00339940 predicted 576
5 SASI_Mm02_00339941 predicted 1709
6 SASI_Mm02_00339942 predicted 1734
7 SASI_Mm02_00339943 predicted 632
8 SASI_Mm02_00339944 predicted 392
9 SASI_Mm02_00339945 predicted 1742
10 SASI_Mm02_00339946 predicted 1107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139226
ONECUT3 MISSION shRNA Bacterial Glycerol Stock
one cut homeobox 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139226.3-1749s21c1
Sequence:CCGGCAAACAGAACCCGGGTATTTACTCGAGTAAATACCCGGGTTCTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139226.3-1337s21c1
Sequence:CCGGAGAAGCAACGCCTCGTGTTCACTCGAGTGAACACGAGGCGTTGCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1045s1c1
Sequence:CCGGGCCGAAGAGATCAACACCAAACTCGAGTTTGGTGTTGATCTCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1371s1c1
Sequence:CCGGCCGCACGCTGATTGCCATCTTCTCGAGAAGATGGCAATCAGCGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139226.3-4239s1c1
Sequence:CCGGCCGTTCTTTCTCCTTGTCTTTCTCGAGAAAGACAAGGAGAAAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1047s1c1
Sequence:CCGGCGAAGAGATCAACACCAAAGACTCGAGTCTTTGGTGTTGATCTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1288s1c1
Sequence:CCGGTGCAAGCGTAAAGAGCAGGATCTCGAGATCCTGCTCTTTACGCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139226
ONECUT3 MISSION shRNA shRNA Plasmid DNA
one cut homeobox 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139226.3-1749s21c1
Sequence:CCGGCAAACAGAACCCGGGTATTTACTCGAGTAAATACCCGGGTTCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139226.3-1337s21c1
Sequence:CCGGAGAAGCAACGCCTCGTGTTCACTCGAGTGAACACGAGGCGTTGCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1045s1c1
Sequence:CCGGGCCGAAGAGATCAACACCAAACTCGAGTTTGGTGTTGATCTCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1371s1c1
Sequence:CCGGCCGCACGCTGATTGCCATCTTCTCGAGAAGATGGCAATCAGCGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139226.3-4239s1c1
Sequence:CCGGCCGTTCTTTCTCCTTGTCTTTCTCGAGAAAGACAAGGAGAAAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1047s1c1
Sequence:CCGGCGAAGAGATCAACACCAAAGACTCGAGTCTTTGGTGTTGATCTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1288s1c1
Sequence:CCGGTGCAAGCGTAAAGAGCAGGATCTCGAGATCCTGCTCTTTACGCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139226
ONECUT3 MISSION shRNA Lentiviral Transduction Particles
one cut homeobox 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139226.3-1749s21c1
Sequence:CCGGCAAACAGAACCCGGGTATTTACTCGAGTAAATACCCGGGTTCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139226.3-1337s21c1
Sequence:CCGGAGAAGCAACGCCTCGTGTTCACTCGAGTGAACACGAGGCGTTGCTTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1045s1c1
Sequence:CCGGGCCGAAGAGATCAACACCAAACTCGAGTTTGGTGTTGATCTCTTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1371s1c1
Sequence:CCGGCCGCACGCTGATTGCCATCTTCTCGAGAAGATGGCAATCAGCGTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139226.3-4239s1c1
Sequence:CCGGCCGTTCTTTCTCCTTGTCTTTCTCGAGAAAGACAAGGAGAAAGAACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1047s1c1
Sequence:CCGGCGAAGAGATCAACACCAAAGACTCGAGTCTTTGGTGTTGATCTCTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139226.3-1288s1c1
Sequence:CCGGTGCAAGCGTAAAGAGCAGGATCTCGAGATCCTGCTCTTTACGCTTGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080488
ONECUT3 MISSION shRNA Bacterial Glycerol Stock
one cut homeobox 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000239380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-1244s21c1
Sequence:CCGGAGAAGCAGCGCCTGGTGTTCACTCGAGTGAACACCAGGCGCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-957s21c1
Sequence:CCGGGGAGATCAACACCAAGGAGGTCTCGAGACCTCCTTGGTGTTGATCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-1282s21c1
Sequence:CCGGACGCTGATCGCCATCTTCAAGCTCGAGCTTGAAGATGGCGATCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-1091s21c1
Sequence:CCGGAGCCGTGGAGCAAGCTCAAATCTCGAGATTTGAGCTTGCTCCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080488
ONECUT3 MISSION shRNA shRNA Plasmid DNA
one cut homeobox 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000239380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-1244s21c1
Sequence:CCGGAGAAGCAGCGCCTGGTGTTCACTCGAGTGAACACCAGGCGCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-957s21c1
Sequence:CCGGGGAGATCAACACCAAGGAGGTCTCGAGACCTCCTTGGTGTTGATCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-1282s21c1
Sequence:CCGGACGCTGATCGCCATCTTCAAGCTCGAGCTTGAAGATGGCGATCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-1091s21c1
Sequence:CCGGAGCCGTGGAGCAAGCTCAAATCTCGAGATTTGAGCTTGCTCCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080488
ONECUT3 MISSION shRNA Lentiviral Transduction Particles
one cut homeobox 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000239380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-1244s21c1
Sequence:CCGGAGAAGCAGCGCCTGGTGTTCACTCGAGTGAACACCAGGCGCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-957s21c1
Sequence:CCGGGGAGATCAACACCAAGGAGGTCTCGAGACCTCCTTGGTGTTGATCTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-1282s21c1
Sequence:CCGGACGCTGATCGCCATCTTCAAGCTCGAGCTTGAAGATGGCGATCAGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080488.1-1091s21c1
Sequence:CCGGAGCCGTGGAGCAAGCTCAAATCTCGAGATTTGAGCTTGCTCCACGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)