EMAIL THIS PAGE TO A FRIEND

OOEP

oocyte expressed protein

41 Gene Product Result for
Synonyms: C6orf156 FLOPED HOEP19 KHDC2
UniProtKB ID: A6NGQ2, A6NIN5, A9UIB7
Gene ID:
Mouse(67968) oocyte expressed protein
dog(474966) oocyte expressed protein
cow(507401) oocyte expressed protein homolog (dog)
domestic cat(768093) oocyte expressed protein homolog (dog)
sheep(101107104) oocyte expressed protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080507 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_496818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496818 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102391 MISSION® esiRNA esiRNA human OOEP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080507 Rosetta Predictions human pricing
XM_496818 Rosetta Predictions human pricing
NM_026480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315507 predicted 255
2 SASI_Hs02_00315508 predicted 433
3 SASI_Hs02_00315509 predicted 310
4 SASI_Hs02_00315510 predicted 349
5 SASI_Hs02_00315511 predicted 397
6 SASI_Hs02_00315512 predicted 381
7 SASI_Hs02_00315513 predicted 353
8 SASI_Hs02_00315514 predicted 261
9 SASI_Hs02_00315515 predicted 441
10 SASI_Hs02_00315516 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251224 predicted 453
2 SASI_Hs01_00251225 predicted 261
3 SASI_Hs01_00251226 predicted 435
4 SASI_Hs01_00251227 predicted 311
5 SASI_Hs01_00251228 predicted 353
6 SASI_Hs01_00251229 predicted 368
7 SASI_Hs01_00251230 predicted 396
8 SASI_Hs01_00251231 predicted 388
9 SASI_Hs01_00251232 predicted 355
10 SASI_Hs01_00251233 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034028 predicted 244
2 SASI_Mm02_00330348 predicted 414
3 SASI_Mm01_00034030 predicted 338
4 SASI_Mm02_00330349 predicted 218
5 SASI_Mm02_00330350 predicted 216
6 SASI_Mm01_00034031 predicted 245
7 SASI_Mm01_00034029 predicted 232
8 SASI_Mm02_00330351 predicted 412
9 SASI_Mm01_00034033 predicted 408
10 SASI_Mm01_00034034 predicted 283
11 SASI_Mm01_00034032 predicted 225
12 SASI_Mm01_00034035 predicted 225
13 SASI_Mm01_00034036 predicted 306
14 SASI_Mm01_00034037 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080507
OOEP MISSION shRNA Bacterial Glycerol Stock
oocyte expressed protein
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000220072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001080507.2-261s1c1
Sequence:CCGGCTCAGGGAACCTAGTCGAAATCTCGAGATTTCGACTAGGTTCCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001080507.2-199s1c1
Sequence:CCGGCGAGCCATAATTCCAGAAATGCTCGAGCATTTCTGGAATTATGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080507
OOEP MISSION shRNA shRNA Plasmid DNA
oocyte expressed protein
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000220072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001080507.2-261s1c1
Sequence:CCGGCTCAGGGAACCTAGTCGAAATCTCGAGATTTCGACTAGGTTCCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001080507.2-199s1c1
Sequence:CCGGCGAGCCATAATTCCAGAAATGCTCGAGCATTTCTGGAATTATGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080507
OOEP MISSION shRNA Lentiviral Transduction Particles
oocyte expressed protein
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000220072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001080507.2-261s1c1
Sequence:CCGGCTCAGGGAACCTAGTCGAAATCTCGAGATTTCGACTAGGTTCCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001080507.2-199s1c1
Sequence:CCGGCGAGCCATAATTCCAGAAATGCTCGAGCATTTCTGGAATTATGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496818
OOEP MISSION shRNA Bacterial Glycerol Stock
oocyte expressed protein
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000204787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496818.1-142s1c1
Sequence:CCGGGACCCTTTGGTGTTCTACCTACTCGAGTAGGTAGAACACCAAAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496818.1-453s1c1
Sequence:CCGGCAACATAGTTACTGTTGGGAACTCGAGTTCCCAACAGTAACTATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496818.1-370s1c1
Sequence:CCGGGCTGAGAAGATGAAACACCTTCTCGAGAAGGTGTTTCATCTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496818
OOEP MISSION shRNA shRNA Plasmid DNA
oocyte expressed protein
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000204787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496818.1-142s1c1
Sequence:CCGGGACCCTTTGGTGTTCTACCTACTCGAGTAGGTAGAACACCAAAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496818.1-453s1c1
Sequence:CCGGCAACATAGTTACTGTTGGGAACTCGAGTTCCCAACAGTAACTATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496818.1-370s1c1
Sequence:CCGGGCTGAGAAGATGAAACACCTTCTCGAGAAGGTGTTTCATCTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496818
OOEP MISSION shRNA Lentiviral Transduction Particles
oocyte expressed protein
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000204787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496818.1-142s1c1
Sequence:CCGGGACCCTTTGGTGTTCTACCTACTCGAGTAGGTAGAACACCAAAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496818.1-453s1c1
Sequence:CCGGCAACATAGTTACTGTTGGGAACTCGAGTTCCCAACAGTAACTATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496818.1-370s1c1
Sequence:CCGGGCTGAGAAGATGAAACACCTTCTCGAGAAGGTGTTTCATCTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026480
OOEP MISSION shRNA Bacterial Glycerol Stock
oocyte expressed protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-465s21c1
Sequence:CCGGCTCAATCCTAAGCAAGTTAAGCTCGAGCTTAACTTGCTTAGGATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.3-551s1c1
Sequence:CCGGCTTAAATCACTACACGTATTTCTCGAGAAATACGTGTAGTGATTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026480.3-664s21c1
Sequence:CCGGGCTGTTGGTTTGATCACATACCTCGAGGTATGTGATCAAACCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-169s21c1
Sequence:CCGGCCAATTCAGGAAGTCAGTAATCTCGAGATTACTGACTTCCTGAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-102s21c1
Sequence:CCGGTGACTCTCAGAAGCTGCTTAACTCGAGTTAAGCAGCTTCTGAGAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.1-170s1c1
Sequence:CCGGCCAATTCAGGAAGTCAGTAATCTCGAGATTACTGACTTCCTGAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.1-260s1c1
Sequence:CCGGGAAATAGAGTGGATGTGCCAACTCGAGTTGGCACATCCACTCTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.1-462s1c1
Sequence:CCGGCCTCCTCAATCCTAAGCAAGTCTCGAGACTTGCTTAGGATTGAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-551s21c1
Sequence:CCGGCTTAAATCACTACACGTATTTCTCGAGAAATACGTGTAGTGATTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026480
OOEP MISSION shRNA shRNA Plasmid DNA
oocyte expressed protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-465s21c1
Sequence:CCGGCTCAATCCTAAGCAAGTTAAGCTCGAGCTTAACTTGCTTAGGATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.3-551s1c1
Sequence:CCGGCTTAAATCACTACACGTATTTCTCGAGAAATACGTGTAGTGATTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026480.3-664s21c1
Sequence:CCGGGCTGTTGGTTTGATCACATACCTCGAGGTATGTGATCAAACCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-169s21c1
Sequence:CCGGCCAATTCAGGAAGTCAGTAATCTCGAGATTACTGACTTCCTGAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-102s21c1
Sequence:CCGGTGACTCTCAGAAGCTGCTTAACTCGAGTTAAGCAGCTTCTGAGAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.1-170s1c1
Sequence:CCGGCCAATTCAGGAAGTCAGTAATCTCGAGATTACTGACTTCCTGAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.1-260s1c1
Sequence:CCGGGAAATAGAGTGGATGTGCCAACTCGAGTTGGCACATCCACTCTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.1-462s1c1
Sequence:CCGGCCTCCTCAATCCTAAGCAAGTCTCGAGACTTGCTTAGGATTGAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-551s21c1
Sequence:CCGGCTTAAATCACTACACGTATTTCTCGAGAAATACGTGTAGTGATTTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026480
OOEP MISSION shRNA Lentiviral Transduction Particles
oocyte expressed protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-465s21c1
Sequence:CCGGCTCAATCCTAAGCAAGTTAAGCTCGAGCTTAACTTGCTTAGGATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.3-551s1c1
Sequence:CCGGCTTAAATCACTACACGTATTTCTCGAGAAATACGTGTAGTGATTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026480.3-664s21c1
Sequence:CCGGGCTGTTGGTTTGATCACATACCTCGAGGTATGTGATCAAACCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-169s21c1
Sequence:CCGGCCAATTCAGGAAGTCAGTAATCTCGAGATTACTGACTTCCTGAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-102s21c1
Sequence:CCGGTGACTCTCAGAAGCTGCTTAACTCGAGTTAAGCAGCTTCTGAGAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.1-170s1c1
Sequence:CCGGCCAATTCAGGAAGTCAGTAATCTCGAGATTACTGACTTCCTGAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.1-260s1c1
Sequence:CCGGGAAATAGAGTGGATGTGCCAACTCGAGTTGGCACATCCACTCTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026480.1-462s1c1
Sequence:CCGGCCTCCTCAATCCTAAGCAAGTCTCGAGACTTGCTTAGGATTGAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026480.3-551s21c1
Sequence:CCGGCTTAAATCACTACACGTATTTCTCGAGAAATACGTGTAGTGATTTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)