EMAIL THIS PAGE TO A FRIEND

OPALIN

oligodendrocytic myelin paranodal and inner loop protein

155 Gene Product Result for
Synonyms: HTMP10 TMEM10 TMP10
UniProtKB ID: Q96PE5, A8MYG4, B4DK96, Q5W102
Gene ID:
Mouse(226115) oligodendrocytic myelin paranodal and inner loop protein
Rat(361757) oligodendrocytic myelin paranodal and inner loop protein
dog(608634) oligodendrocytic myelin paranodal and inner loop protein
domestic cat(101097350) oligodendrocytic myelin paranodal and inner loop protein
cow(616443) oligodendrocytic myelin paranodal and inner loop protein
domestic guinea pig(100713253) oligodendrocytic myelin paranodal and inner loop protein
naked mole-rat(101719659) oligodendrocytic myelin paranodal and inner loop protein
sheep(101111761) oligodendrocytic myelin paranodal and inner loop protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040102 Rosetta Predictions human pricing
NM_001040103 Rosetta Predictions human pricing
NM_033207 Rosetta Predictions human pricing
NM_001017386 Rosetta Predictions rat pricing
NM_153520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138774 predicted 661
2 SASI_Hs01_00138775 predicted 729
3 SASI_Hs02_00308822 predicted 567
4 SASI_Hs01_00138776 predicted 1023
5 SASI_Hs01_00138777 predicted 824
6 SASI_Hs01_00138778 predicted 876
7 SASI_Hs01_00138779 predicted 870
8 SASI_Hs01_00138780 predicted 558
9 SASI_Hs01_00138783 predicted 1193
10 SASI_Hs02_00308823 predicted 884
11 SASI_Hs01_00138781 predicted 1249
12 SASI_Hs01_00138782 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110390 predicted 766
2 SASI_Hs01_00110391 predicted 831
3 SASI_Hs02_00308824 predicted 672
4 SASI_Hs01_00110392 predicted 1130
5 SASI_Hs01_00110393 predicted 933
6 SASI_Hs01_00110394 predicted 982
7 SASI_Hs01_00110395 predicted 978
8 SASI_Hs01_00110396 predicted 669
9 SASI_Hs01_00110399 predicted 1300
10 SASI_Hs02_00308825 predicted 992
11 SASI_Hs01_00110397 predicted 1350
12 SASI_Hs01_00110398 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028682 predicted 727
2 SASI_Hs01_00028683 predicted 799
3 SASI_Hs01_00028684 predicted 1090
4 SASI_Hs01_00028685 predicted 577
5 SASI_Hs02_00360995 predicted 1155
6 SASI_Hs01_00028686 predicted 1046
7 SASI_Hs01_00028687 predicted 945
8 SASI_Hs01_00028689 predicted 946
9 SASI_Hs01_00028690 predicted 1217
10 SASI_Hs02_00360996 predicted 733
11 SASI_Hs01_00028688 predicted 1318
12 SASI_Hs01_00028691 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068799 predicted 434
2 SASI_Rn01_00068800 predicted 552
3 SASI_Rn01_00068801 predicted 315
4 SASI_Rn01_00068802 predicted 545
5 SASI_Rn01_00068803 predicted 279
6 SASI_Rn01_00068804 predicted 250
7 SASI_Rn02_00202231 predicted 376
8 SASI_Rn01_00068805 predicted 552
9 SASI_Rn01_00068807 predicted 277
10 SASI_Rn01_00068808 predicted 549
11 SASI_Rn01_00068806 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092951 predicted 372
2 SASI_Mm01_00092952 predicted 433
3 SASI_Mm01_00092953 predicted 251
4 SASI_Mm01_00092954 predicted 276
5 SASI_Mm01_00092955 predicted 278
6 SASI_Mm01_00092957 predicted 278
7 SASI_Mm02_00343278 predicted 564
8 SASI_Mm01_00092958 predicted 368
9 SASI_Mm01_00092959 predicted 508
10 SASI_Mm01_00092960 predicted 246
11 SASI_Mm01_00092956 predicted 600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033207
OPALIN MISSION shRNA Bacterial Glycerol Stock
oligodendrocytic myelin paranodal and inner loop protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-569s1c1
Sequence:CCGGCACCGAAGAAGAAGCAGCATTCTCGAGAATGCTGCTTCTTCTTCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-683s1c1
Sequence:CCGGGAGAAGAATACGATGGGAGCACTCGAGTGCTCCCATCGTATTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033207.2-602s1c1
Sequence:CCGGGAAAGTGACAGACCATGTGAACTCGAGTTCACATGGTCTGTCACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033207.2-710s1c1
Sequence:CCGGGCCCACATATATGTGAAGACTCTCGAGAGTCTTCACATATATGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-627s1c1
Sequence:CCGGCAGAAATTGATGACAATCCCACTCGAGTGGGATTGTCATCAATTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033207.2-3194s1c1
Sequence:CCGGGCCTTGGCTTTGATACTTATACTCGAGTATAAGTATCAAAGCCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-640s1c1
Sequence:CCGGCAATCCCAAGATATCTGAGAACTCGAGTTCTCAGATATCTTGGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033207.2-3251s1c1
Sequence:CCGGGCCTCAGTTCTGTACTTGTAACTCGAGTTACAAGTACAGAACTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033207.2-1548s1c1
Sequence:CCGGGCTACTTAGTTGCCAGTCAAACTCGAGTTTGACTGGCAACTAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033207
OPALIN MISSION shRNA shRNA Plasmid DNA
oligodendrocytic myelin paranodal and inner loop protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-569s1c1
Sequence:CCGGCACCGAAGAAGAAGCAGCATTCTCGAGAATGCTGCTTCTTCTTCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-683s1c1
Sequence:CCGGGAGAAGAATACGATGGGAGCACTCGAGTGCTCCCATCGTATTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033207.2-602s1c1
Sequence:CCGGGAAAGTGACAGACCATGTGAACTCGAGTTCACATGGTCTGTCACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033207.2-710s1c1
Sequence:CCGGGCCCACATATATGTGAAGACTCTCGAGAGTCTTCACATATATGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-627s1c1
Sequence:CCGGCAGAAATTGATGACAATCCCACTCGAGTGGGATTGTCATCAATTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033207.2-3194s1c1
Sequence:CCGGGCCTTGGCTTTGATACTTATACTCGAGTATAAGTATCAAAGCCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-640s1c1
Sequence:CCGGCAATCCCAAGATATCTGAGAACTCGAGTTCTCAGATATCTTGGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033207.2-3251s1c1
Sequence:CCGGGCCTCAGTTCTGTACTTGTAACTCGAGTTACAAGTACAGAACTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033207.2-1548s1c1
Sequence:CCGGGCTACTTAGTTGCCAGTCAAACTCGAGTTTGACTGGCAACTAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033207
OPALIN MISSION shRNA Lentiviral Transduction Particles
oligodendrocytic myelin paranodal and inner loop protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-569s1c1
Sequence:CCGGCACCGAAGAAGAAGCAGCATTCTCGAGAATGCTGCTTCTTCTTCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-683s1c1
Sequence:CCGGGAGAAGAATACGATGGGAGCACTCGAGTGCTCCCATCGTATTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033207.2-602s1c1
Sequence:CCGGGAAAGTGACAGACCATGTGAACTCGAGTTCACATGGTCTGTCACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033207.2-710s1c1
Sequence:CCGGGCCCACATATATGTGAAGACTCTCGAGAGTCTTCACATATATGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-627s1c1
Sequence:CCGGCAGAAATTGATGACAATCCCACTCGAGTGGGATTGTCATCAATTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033207.2-3194s1c1
Sequence:CCGGGCCTTGGCTTTGATACTTATACTCGAGTATAAGTATCAAAGCCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033207.2-640s1c1
Sequence:CCGGCAATCCCAAGATATCTGAGAACTCGAGTTCTCAGATATCTTGGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033207.2-3251s1c1
Sequence:CCGGGCCTCAGTTCTGTACTTGTAACTCGAGTTACAAGTACAGAACTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033207.2-1548s1c1
Sequence:CCGGGCTACTTAGTTGCCAGTCAAACTCGAGTTTGACTGGCAACTAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153520
OPALIN MISSION shRNA Bacterial Glycerol Stock
oligodendrocytic myelin paranodal and inner loop protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153520.1-607s1c1
Sequence:CCGGCCTCTCACTCAACATCAATTTCTCGAGAAATTGATGTTGAGTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-303s1c1
Sequence:CCGGGAACTCTATGACAATCCCAAACTCGAGTTTGGGATTGTCATAGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-277s1c1
Sequence:CCGGAGACTGAGATACCATGTGAAACTCGAGTTTCACATGGTATCTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-276s1c1
Sequence:CCGGGAGACTGAGATACCATGTGAACTCGAGTTCACATGGTATCTCAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-468s1c1
Sequence:CCGGAGAGGACTTTGGTGGCTTGTACTCGAGTACAAGCCACCAAAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153520
OPALIN MISSION shRNA shRNA Plasmid DNA
oligodendrocytic myelin paranodal and inner loop protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153520.1-607s1c1
Sequence:CCGGCCTCTCACTCAACATCAATTTCTCGAGAAATTGATGTTGAGTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-303s1c1
Sequence:CCGGGAACTCTATGACAATCCCAAACTCGAGTTTGGGATTGTCATAGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-277s1c1
Sequence:CCGGAGACTGAGATACCATGTGAAACTCGAGTTTCACATGGTATCTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-276s1c1
Sequence:CCGGGAGACTGAGATACCATGTGAACTCGAGTTCACATGGTATCTCAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-468s1c1
Sequence:CCGGAGAGGACTTTGGTGGCTTGTACTCGAGTACAAGCCACCAAAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153520
OPALIN MISSION shRNA Lentiviral Transduction Particles
oligodendrocytic myelin paranodal and inner loop protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153520.1-607s1c1
Sequence:CCGGCCTCTCACTCAACATCAATTTCTCGAGAAATTGATGTTGAGTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-303s1c1
Sequence:CCGGGAACTCTATGACAATCCCAAACTCGAGTTTGGGATTGTCATAGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-277s1c1
Sequence:CCGGAGACTGAGATACCATGTGAAACTCGAGTTTCACATGGTATCTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-276s1c1
Sequence:CCGGGAGACTGAGATACCATGTGAACTCGAGTTCACATGGTATCTCAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153520.1-468s1c1
Sequence:CCGGAGAGGACTTTGGTGGCTTGTACTCGAGTACAAGCCACCAAAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)