EMAIL THIS PAGE TO A FRIEND

OPCML

opioid binding protein/cell adhesion molecule-like

314 Gene Product Result for
Synonyms: IGLON1 OBCAM OPCM
UniProtKB ID: Q14982, Q17RN7, Q7Z3W6
Gene ID:
Human(4978) Summary: This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily. The encoded protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(330908) opioid binding protein/cell adhesion molecule-like
Rat(116597) opioid binding protein/cell adhesion molecule-like
Zebrafish(449538) opioid binding protein/cell adhesion molecule-like
chicken(395422) opioid binding protein/cell adhesion molecule-like
dog(100686219) opioid binding protein/cell adhesion molecule-like
domestic cat(101094787) opioid binding protein/cell adhesion molecule-like
cow(281957) opioid binding protein/cell adhesion molecule-like
Horse(100064790) opioid binding protein/cell adhesion molecule-like
sheep(101117888) opioid binding protein/cell adhesion molecule-like
naked mole-rat(101701924) opioid binding protein/cell adhesion molecule-like
domestic guinea pig(100728436) opioid binding protein/cell adhesion molecule-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1615 Human OBCAM ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002545 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177906 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177906 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177906 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012393 Rosetta Predictions human pricing
NM_002545 Rosetta Predictions human pricing
NM_053848 Rosetta Predictions rat pricing
NM_177906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080395 predicted 1559
2 SASI_Hs01_00080396 predicted 1575
3 SASI_Hs01_00080397 predicted 999
4 SASI_Hs01_00080399 predicted 1589
5 SASI_Hs02_00306088 predicted 823
6 SASI_Hs01_00080400 predicted 1687
7 SASI_Hs01_00080401 predicted 849
8 SASI_Hs01_00080402 predicted 682
9 SASI_Hs01_00080403 predicted 1625
10 SASI_Hs01_00080404 predicted 814
11 SASI_Hs01_00080398 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120322 predicted 1454
2 SASI_Hs01_00120323 predicted 1463
3 SASI_Hs01_00120324 predicted 888
4 SASI_Hs01_00120326 predicted 1474
5 SASI_Hs02_00334034 predicted 704
6 SASI_Hs01_00120327 predicted 1573
7 SASI_Hs01_00120328 predicted 736
8 SASI_Hs01_00120329 predicted 570
9 SASI_Hs01_00120330 predicted 1510
10 SASI_Hs01_00120331 predicted 699
11 SASI_Hs01_00120325 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034382 predicted 666
2 SASI_Rn01_00034383 predicted 1294
3 SASI_Rn01_00034384 predicted 893
4 SASI_Rn01_00034387 predicted 925
5 SASI_Rn01_00034388 predicted 1035
6 SASI_Rn02_00266701 predicted 1323
7 SASI_Rn01_00034390 predicted 958
8 SASI_Rn01_00034391 predicted 1127
9 SASI_Rn02_00266702 predicted 724
10 SASI_Rn02_00266703 predicted 1353
11 SASI_Rn01_00034385 predicted 1313
12 SASI_Rn01_00034386 predicted 724
13 SASI_Rn01_00034389 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022346 predicted 742
2 SASI_Mm01_00022347 predicted 926
3 SASI_Mm01_00022348 predicted 759
4 SASI_Mm02_00348391 predicted 941
5 SASI_Mm01_00022349 predicted 298
6 SASI_Mm01_00022350 predicted 592
7 SASI_Mm01_00022351 predicted 774
8 SASI_Mm01_00022352 predicted 382
9 SASI_Mm01_00022354 predicted 980
10 SASI_Mm01_00022355 predicted 637
11 SASI_Mm01_00022353 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002545
OPCML MISSION shRNA Bacterial Glycerol Stock
opioid binding protein/cell adhesion molecule-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-429s1c1
Sequence:CCGGCGGGTTCACCTAATAGTGCAACTCGAGTTGCACTATTAGGTGAACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-464s1c1
Sequence:CCGGCATGAATATCTCCTCAGACATCTCGAGATGTCTGAGGAGATATTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-994s1c1
Sequence:CCGGGAGCAGTCATTGATGGTGTAACTCGAGTTACACCATCAATGACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-339s1c1
Sequence:CCGGCAGTACAGCATCATGATCCAACTCGAGTTGGATCATGATGCTGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-401s1c1
Sequence:CCGGGCAGACAGACAATCATCCCAACTCGAGTTGGGATGATTGTCTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002545.3-1295s21c1
Sequence:CCGGCCACGTGTAGGATAATCATTCCTCGAGGAATGATTATCCTACACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002545.3-680s21c1
Sequence:CCGGGCCCGATGTGCGGAAAGTAAACTCGAGTTTACTTTCCGCACATCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002545.3-1513s21c1
Sequence:CCGGTACATCCAAGTGTCCTATTATCTCGAGATAATAGGACACTTGGATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002545.3-708s21c1
Sequence:CCGGGTAAACTATCCTCCCTATATCCTCGAGGATATAGGGAGGATAGTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002545
OPCML MISSION shRNA shRNA Plasmid DNA
opioid binding protein/cell adhesion molecule-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-429s1c1
Sequence:CCGGCGGGTTCACCTAATAGTGCAACTCGAGTTGCACTATTAGGTGAACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-464s1c1
Sequence:CCGGCATGAATATCTCCTCAGACATCTCGAGATGTCTGAGGAGATATTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-994s1c1
Sequence:CCGGGAGCAGTCATTGATGGTGTAACTCGAGTTACACCATCAATGACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-339s1c1
Sequence:CCGGCAGTACAGCATCATGATCCAACTCGAGTTGGATCATGATGCTGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-401s1c1
Sequence:CCGGGCAGACAGACAATCATCCCAACTCGAGTTGGGATGATTGTCTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002545.3-1295s21c1
Sequence:CCGGCCACGTGTAGGATAATCATTCCTCGAGGAATGATTATCCTACACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002545.3-680s21c1
Sequence:CCGGGCCCGATGTGCGGAAAGTAAACTCGAGTTTACTTTCCGCACATCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002545.3-1513s21c1
Sequence:CCGGTACATCCAAGTGTCCTATTATCTCGAGATAATAGGACACTTGGATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002545.3-708s21c1
Sequence:CCGGGTAAACTATCCTCCCTATATCCTCGAGGATATAGGGAGGATAGTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002545
OPCML MISSION shRNA Lentiviral Transduction Particles
opioid binding protein/cell adhesion molecule-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-429s1c1
Sequence:CCGGCGGGTTCACCTAATAGTGCAACTCGAGTTGCACTATTAGGTGAACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-464s1c1
Sequence:CCGGCATGAATATCTCCTCAGACATCTCGAGATGTCTGAGGAGATATTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-994s1c1
Sequence:CCGGGAGCAGTCATTGATGGTGTAACTCGAGTTACACCATCAATGACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-339s1c1
Sequence:CCGGCAGTACAGCATCATGATCCAACTCGAGTTGGATCATGATGCTGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002545.2-401s1c1
Sequence:CCGGGCAGACAGACAATCATCCCAACTCGAGTTGGGATGATTGTCTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002545.3-1295s21c1
Sequence:CCGGCCACGTGTAGGATAATCATTCCTCGAGGAATGATTATCCTACACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002545.3-680s21c1
Sequence:CCGGGCCCGATGTGCGGAAAGTAAACTCGAGTTTACTTTCCGCACATCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002545.3-1513s21c1
Sequence:CCGGTACATCCAAGTGTCCTATTATCTCGAGATAATAGGACACTTGGATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002545.3-708s21c1
Sequence:CCGGGTAAACTATCCTCCCTATATCCTCGAGGATATAGGGAGGATAGTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177906
OPCML MISSION shRNA Bacterial Glycerol Stock
opioid binding protein/cell adhesion molecule-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-921s1c1
Sequence:CCGGCCGCATATCCACTTTGACTTTCTCGAGAAAGTCAAAGTGGATATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177906.3-1725s1c1
Sequence:CCGGGCTGCCTAACTGCATCCTTAACTCGAGTTAAGGATGCAGTTAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-545s1c1
Sequence:CCGGGAAGCAGTGTGACCCTGTTATCTCGAGATAACAGGGTCACACTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-378s1c1
Sequence:CCGGGCCTACCCAATACAGTATCATCTCGAGATGATACTGTATTGGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-721s1c1
Sequence:CCGGGCACCTGATGTTCGGAAAGTACTCGAGTACTTTCCGAACATCAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177906
OPCML MISSION shRNA shRNA Plasmid DNA
opioid binding protein/cell adhesion molecule-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-921s1c1
Sequence:CCGGCCGCATATCCACTTTGACTTTCTCGAGAAAGTCAAAGTGGATATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177906.3-1725s1c1
Sequence:CCGGGCTGCCTAACTGCATCCTTAACTCGAGTTAAGGATGCAGTTAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-545s1c1
Sequence:CCGGGAAGCAGTGTGACCCTGTTATCTCGAGATAACAGGGTCACACTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-378s1c1
Sequence:CCGGGCCTACCCAATACAGTATCATCTCGAGATGATACTGTATTGGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-721s1c1
Sequence:CCGGGCACCTGATGTTCGGAAAGTACTCGAGTACTTTCCGAACATCAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177906
OPCML MISSION shRNA Lentiviral Transduction Particles
opioid binding protein/cell adhesion molecule-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-921s1c1
Sequence:CCGGCCGCATATCCACTTTGACTTTCTCGAGAAAGTCAAAGTGGATATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177906.3-1725s1c1
Sequence:CCGGGCTGCCTAACTGCATCCTTAACTCGAGTTAAGGATGCAGTTAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-545s1c1
Sequence:CCGGGAAGCAGTGTGACCCTGTTATCTCGAGATAACAGGGTCACACTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-378s1c1
Sequence:CCGGGCCTACCCAATACAGTATCATCTCGAGATGATACTGTATTGGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177906.3-721s1c1
Sequence:CCGGGCACCTGATGTTCGGAAAGTACTCGAGTACTTTCCGAACATCAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)