EMAIL THIS PAGE TO A FRIEND

OPN1LW

opsin 1 (cone pigments), long-wave-sensitive

19 Gene Product Result for
Synonyms: CBBM CBP COD5 RCP ROP
UniProtKB ID: P04000
Gene ID:
Human(5956) Summary: This gene encodes for a light absorbing visual pigment of the opsin gene family. The encoded protein is called red cone photopigment or long-wavelength sensitive opsin. Opsins are G-protein coupled receptors with seven transmembrane domains, an N-terminal extracellular domain, and a C-terminal cytoplasmic domain. This gene and the medium-wavelength opsin gene are tandemly arrayed on the X chromosome and frequent unequal recombination and gene conversion may occur between these sequences. X chromosomes may have fusions of the medium- and long-wavelength opsin genes or may have more than one copy of these genes. Defects in this gene are the cause of partial, protanopic colorblindness. [provided by RefSeq, Jul 2008]
Mouse(20164) opsin 1 (cone pigments), long-wave-sensitive
chicken(396421) opsin 1 (cone pigments), long-wave-sensitive (color blindness, protan)
dog(403778) opsin 1 (cone pigments), long-wave-sensitive
domestic cat(493959) opsin 1 (cone pigments), long-wave-sensitive
Horse(100033892) opsin 1 (cone pigments), long-wave-sensitive
cow(282293) opsin 1 (cone pigments), long-wave-sensitive
sheep(101109774) opsin 1 (cone pigments), long-wave-sensitive
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020061 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148671 MISSION® esiRNA esiRNA human OPN1LW (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020061 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062349 predicted 215
2 SASI_Hs01_00062350 predicted 724
3 SASI_Hs01_00062351 predicted 218
4 SASI_Hs01_00062352 predicted 912
5 SASI_Hs01_00062353 predicted 224
6 SASI_Hs01_00062354 predicted 876
7 SASI_Hs01_00062355 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020061
OPN1LW MISSION shRNA Bacterial Glycerol Stock
opsin 1 (cone pigments), long-wave-sensitive
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-696s1c1
Sequence:CCGGCGCTATCATCATGCTCTGCTACTCGAGTAGCAGAGCATGATGATAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-680s1c1
Sequence:CCGGGCTGCATCATCCCACTCGCTACTCGAGTAGCGAGTGGGATGATGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-472s1c1
Sequence:CCGGCCCTTTGGCAATGTGAGATTTCTCGAGAAATCTCACATTGCCAAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-318s1c1
Sequence:CCGGCAGCACTATCAGCATTGTGAACTCGAGTTCACAATGCTGATAGTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-816s1c1
Sequence:CCGGGATGATCTTTGCGTACTGCGTCTCGAGACGCAGTACGCAAAGATCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020061.4-715s21c1
Sequence:CCGGTGCATCATCCCACTCGCTATCCTCGAGGATAGCGAGTGGGATGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020061.4-730s21c1
Sequence:CCGGGCTATCATCATGCTCTGCTACCTCGAGGTAGCAGAGCATGATGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020061.4-854s21c1
Sequence:CCGGTCTTTGCGTACTGCGTCTGCTCTCGAGAGCAGACGCAGTACGCAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020061
OPN1LW MISSION shRNA shRNA Plasmid DNA
opsin 1 (cone pigments), long-wave-sensitive
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-696s1c1
Sequence:CCGGCGCTATCATCATGCTCTGCTACTCGAGTAGCAGAGCATGATGATAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-680s1c1
Sequence:CCGGGCTGCATCATCCCACTCGCTACTCGAGTAGCGAGTGGGATGATGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-472s1c1
Sequence:CCGGCCCTTTGGCAATGTGAGATTTCTCGAGAAATCTCACATTGCCAAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-318s1c1
Sequence:CCGGCAGCACTATCAGCATTGTGAACTCGAGTTCACAATGCTGATAGTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-816s1c1
Sequence:CCGGGATGATCTTTGCGTACTGCGTCTCGAGACGCAGTACGCAAAGATCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020061.4-715s21c1
Sequence:CCGGTGCATCATCCCACTCGCTATCCTCGAGGATAGCGAGTGGGATGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020061.4-730s21c1
Sequence:CCGGGCTATCATCATGCTCTGCTACCTCGAGGTAGCAGAGCATGATGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020061.4-854s21c1
Sequence:CCGGTCTTTGCGTACTGCGTCTGCTCTCGAGAGCAGACGCAGTACGCAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020061
OPN1LW MISSION shRNA Lentiviral Transduction Particles
opsin 1 (cone pigments), long-wave-sensitive
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-696s1c1
Sequence:CCGGCGCTATCATCATGCTCTGCTACTCGAGTAGCAGAGCATGATGATAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-680s1c1
Sequence:CCGGGCTGCATCATCCCACTCGCTACTCGAGTAGCGAGTGGGATGATGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-472s1c1
Sequence:CCGGCCCTTTGGCAATGTGAGATTTCTCGAGAAATCTCACATTGCCAAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-318s1c1
Sequence:CCGGCAGCACTATCAGCATTGTGAACTCGAGTTCACAATGCTGATAGTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020061.1-816s1c1
Sequence:CCGGGATGATCTTTGCGTACTGCGTCTCGAGACGCAGTACGCAAAGATCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020061.4-715s21c1
Sequence:CCGGTGCATCATCCCACTCGCTATCCTCGAGGATAGCGAGTGGGATGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020061.4-730s21c1
Sequence:CCGGGCTATCATCATGCTCTGCTACCTCGAGGTAGCAGAGCATGATGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020061.4-854s21c1
Sequence:CCGGTCTTTGCGTACTGCGTCTGCTCTCGAGAGCAGACGCAGTACGCAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)