EMAIL THIS PAGE TO A FRIEND

OPN1MW

opsin 1 (cone pigments), medium-wave-sensitive

46 Gene Product Result for
Synonyms: CBBM CBD COD5 GCP GOP OPN1MW1
UniProtKB ID: P04001
Gene ID:
Human(2652) Summary: This gene encodes for a light absorbing visual pigment of the opsin gene family. The encoded protein is called green cone photopigment or medium-wavelength sensitive opsin. Opsins are G-protein coupled receptors with seven transmembrane domains, an N-terminal extracellular domain, and a C-terminal cytoplasmic domain. The long-wavelength opsin gene and multiple copies of the medium-wavelength opsin gene are tandemly arrayed on the X chromosome and frequent unequal recombination and gene conversion may occur between these sequences. X chromosomes may have fusions of the medium- and long-wavelength opsin genes or may have more than one copy of these genes. Defects in this gene are the cause of deutanopic colorblindness. [provided by RefSeq, Mar 2009]
Mouse(14539) opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan)
Rat(89810) opsin 1 (cone pigments), medium-wave-sensitive
domestic guinea pig(100135586) opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107449 Anti-OPN1MW antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2107452 Anti-OPN1MW antibody produced in rabbit affinity isolated antibody human, horse, rabbit, rat, mouse, goat, bovine, guinea pig, dog
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000513 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074941 MISSION® esiRNA esiRNA targeting mouse Opn1mw (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000513 Rosetta Predictions human pricing
NM_053548 Rosetta Predictions rat pricing
NM_008106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222881 predicted 688
2 SASI_Hs01_00222882 predicted 450
3 SASI_Hs01_00222883 predicted 320
4 SASI_Hs01_00222884 predicted 684
5 SASI_Hs01_00222885 predicted 841
6 SASI_Hs01_00222886 predicted 183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266189 predicted 231
2 SASI_Rn01_00091917 predicted 457
3 SASI_Rn01_00091918 predicted 442
4 SASI_Rn01_00091920 predicted 746
5 SASI_Rn02_00266190 predicted 264
6 SASI_Rn01_00091921 predicted 595
7 SASI_Rn02_00266191 predicted 568
8 SASI_Rn01_00091923 predicted 368
9 SASI_Rn01_00091924 predicted 825
10 SASI_Rn01_00091925 predicted 214
11 SASI_Rn01_00091919 predicted 244
12 SASI_Rn01_00091922 predicted 676
13 SASI_Rn01_00091926 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189494 predicted 480
2 SASI_Mm02_00313151 predicted 367
3 SASI_Mm01_00189495 predicted 215
4 SASI_Mm01_00189496 predicted 709
5 SASI_Mm01_00189497 predicted 300
6 SASI_Mm02_00313152 predicted 217
7 SASI_Mm01_00189498 predicted 830
8 SASI_Mm01_00189499 predicted 872
9 SASI_Mm01_00189500 predicted 413
10 SASI_Mm01_00189501 predicted 941
11 SASI_Mm01_00189502 predicted 500
12 SASI_Mm01_00189503 predicted 326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000513
OPN1MW MISSION shRNA Bacterial Glycerol Stock
opsin 1 (cone pigments), medium-wave-sensitive
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1418s21c1
Sequence:CCGGTGTCTACCGATGGCGTGAAAGCTCGAGCTTTCACGCCATCGGTAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1284s21c1
Sequence:CCGGCAAAGTCACAGAGGCTTTCACCTCGAGGTGAAAGCCTCTGTGACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1382s21c1
Sequence:CCGGGAGCGCTTCATAGACTTTAAGCTCGAGCTTAAAGTCTATGAAGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1430s21c1
Sequence:CCGGGCGTGAAAGGATCCTGGCAAACTCGAGTTTGCCAGGATCCTTTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-696s1c1
Sequence:CCGGCAGCATCATCGTGCTCTGCTACTCGAGTAGCAGAGCACGATGATGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-450s1c1
Sequence:CCGGGAGATGGATGGTGGTCTGCAACTCGAGTTGCAGACCACCATCCATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-752s1c1
Sequence:CCGGAGCAGCAGAAAGAGTCTGAATCTCGAGATTCAGACTCTTTCTGCTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-175s1c1
Sequence:CCGGTGGATGATCTTTGTGGTCATTCTCGAGAATGACCACAAAGATCATCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-318s1c1
Sequence:CCGGCAGCACTATCAGCGTTGTGAACTCGAGTTCACAACGCTGATAGTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000513
OPN1MW MISSION shRNA shRNA Plasmid DNA
opsin 1 (cone pigments), medium-wave-sensitive
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1418s21c1
Sequence:CCGGTGTCTACCGATGGCGTGAAAGCTCGAGCTTTCACGCCATCGGTAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1284s21c1
Sequence:CCGGCAAAGTCACAGAGGCTTTCACCTCGAGGTGAAAGCCTCTGTGACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1382s21c1
Sequence:CCGGGAGCGCTTCATAGACTTTAAGCTCGAGCTTAAAGTCTATGAAGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1430s21c1
Sequence:CCGGGCGTGAAAGGATCCTGGCAAACTCGAGTTTGCCAGGATCCTTTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-696s1c1
Sequence:CCGGCAGCATCATCGTGCTCTGCTACTCGAGTAGCAGAGCACGATGATGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-450s1c1
Sequence:CCGGGAGATGGATGGTGGTCTGCAACTCGAGTTGCAGACCACCATCCATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-752s1c1
Sequence:CCGGAGCAGCAGAAAGAGTCTGAATCTCGAGATTCAGACTCTTTCTGCTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-175s1c1
Sequence:CCGGTGGATGATCTTTGTGGTCATTCTCGAGAATGACCACAAAGATCATCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-318s1c1
Sequence:CCGGCAGCACTATCAGCGTTGTGAACTCGAGTTCACAACGCTGATAGTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000513
OPN1MW MISSION shRNA Lentiviral Transduction Particles
opsin 1 (cone pigments), medium-wave-sensitive
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1418s21c1
Sequence:CCGGTGTCTACCGATGGCGTGAAAGCTCGAGCTTTCACGCCATCGGTAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1284s21c1
Sequence:CCGGCAAAGTCACAGAGGCTTTCACCTCGAGGTGAAAGCCTCTGTGACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1382s21c1
Sequence:CCGGGAGCGCTTCATAGACTTTAAGCTCGAGCTTAAAGTCTATGAAGCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000513.2-1430s21c1
Sequence:CCGGGCGTGAAAGGATCCTGGCAAACTCGAGTTTGCCAGGATCCTTTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-696s1c1
Sequence:CCGGCAGCATCATCGTGCTCTGCTACTCGAGTAGCAGAGCACGATGATGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-450s1c1
Sequence:CCGGGAGATGGATGGTGGTCTGCAACTCGAGTTGCAGACCACCATCCATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-752s1c1
Sequence:CCGGAGCAGCAGAAAGAGTCTGAATCTCGAGATTCAGACTCTTTCTGCTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-175s1c1
Sequence:CCGGTGGATGATCTTTGTGGTCATTCTCGAGAATGACCACAAAGATCATCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000513.1-318s1c1
Sequence:CCGGCAGCACTATCAGCGTTGTGAACTCGAGTTCACAACGCTGATAGTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008106
OPN1MW MISSION shRNA Bacterial Glycerol Stock
opsin 1 (cone pigments), medium-wave-sensitive
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-979s1c1
Sequence:CCGGGTCTTTATGAACCGGCAGTTTCTCGAGAAACTGCCGGTTCATAAAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-754s1c1
Sequence:CCGGGCAGTGGCAAAGCAACAGAAACTCGAGTTTCTGTTGCTTTGCCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-1007s1c1
Sequence:CCGGGCATCTTACATCTCTTTGGAACTCGAGTTCCAAAGAGATGTAAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-927s1c1
Sequence:CCGGCCTACCATCCTACTTTGCCAACTCGAGTTGGCAAAGTAGGATGGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-330s1c1
Sequence:CCGGCAGCACTATCAGTGTTGTGAACTCGAGTTCACAACACTGATAGTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008106
OPN1MW MISSION shRNA shRNA Plasmid DNA
opsin 1 (cone pigments), medium-wave-sensitive
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-979s1c1
Sequence:CCGGGTCTTTATGAACCGGCAGTTTCTCGAGAAACTGCCGGTTCATAAAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-754s1c1
Sequence:CCGGGCAGTGGCAAAGCAACAGAAACTCGAGTTTCTGTTGCTTTGCCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-1007s1c1
Sequence:CCGGGCATCTTACATCTCTTTGGAACTCGAGTTCCAAAGAGATGTAAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-927s1c1
Sequence:CCGGCCTACCATCCTACTTTGCCAACTCGAGTTGGCAAAGTAGGATGGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-330s1c1
Sequence:CCGGCAGCACTATCAGTGTTGTGAACTCGAGTTCACAACACTGATAGTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008106
OPN1MW MISSION shRNA Lentiviral Transduction Particles
opsin 1 (cone pigments), medium-wave-sensitive
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-979s1c1
Sequence:CCGGGTCTTTATGAACCGGCAGTTTCTCGAGAAACTGCCGGTTCATAAAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-754s1c1
Sequence:CCGGGCAGTGGCAAAGCAACAGAAACTCGAGTTTCTGTTGCTTTGCCACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-1007s1c1
Sequence:CCGGGCATCTTACATCTCTTTGGAACTCGAGTTCCAAAGAGATGTAAGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-927s1c1
Sequence:CCGGCCTACCATCCTACTTTGCCAACTCGAGTTGGCAAAGTAGGATGGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008106.1-330s1c1
Sequence:CCGGCAGCACTATCAGTGTTGTGAACTCGAGTTCACAACACTGATAGTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)