EMAIL THIS PAGE TO A FRIEND

OPN1SW

opsin 1 (cone pigments), short-wave-sensitive

59 Gene Product Result for
Synonyms: BCP BOP CBT
UniProtKB ID: P03999, Q13877
Gene ID:
Human(611) Summary: This gene belongs to the G-protein coupled receptor 1 family, opsin subfamily. It encodes the blue cone pigment gene which is one of three types of cone photoreceptors responsible for normal color vision. Defects in this gene are the cause of tritan color blindness (tritanopia). Affected individuals lack blue and yellow sensory mechanisms while retaining those for red and green. Defective blue vision is characteristic. [provided by RefSeq, Jul 2008]
Mouse(12057) opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)
Rat(81644) opsin 1 (cone pigments), short-wave-sensitive
chicken(396419) opsin 1 (cone pigments), short-wave-sensitive (violet cone opsin)
cow(282294) opsin 1 (cone pigments), short-wave-sensitive
domestic cat(101080701) opsin 1 (cone pigments), short-wave-sensitive
dog(482267) opsin 1 (cone pigments), short-wave-sensitive
naked mole-rat(101718599) opsin 1 (cone pigments), short-wave-sensitive
domestic guinea pig(100379279) opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)
sheep(101112218) opsin 1 (cone pigments), short-wave-sensitive
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001708 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034071 MISSION® esiRNA esiRNA human OPN1SW (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001708 Rosetta Predictions human pricing
NM_031015 Rosetta Predictions rat pricing
NM_007538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332393 predicted 334
2 SASI_Hs02_00332394 predicted 601
3 SASI_Hs02_00332395 predicted 801
4 SASI_Hs01_00125356 predicted 289
5 SASI_Hs01_00125357 predicted 385
6 SASI_Hs01_00125358 predicted 590
7 SASI_Hs01_00125361 predicted 714
8 SASI_Hs01_00125363 predicted 834
9 SASI_Hs02_00332396 predicted 557
10 SASI_Hs02_00332397 predicted 458
11 SASI_Hs01_00125354 predicted 884
12 SASI_Hs01_00125355 predicted 716
13 SASI_Hs01_00125359 predicted 282
14 SASI_Hs01_00125360 predicted 499
15 SASI_Hs01_00125362 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264206 predicted 1123
2 SASI_Rn01_00060136 predicted 630
3 SASI_Rn01_00060137 predicted 784
4 SASI_Rn01_00060139 predicted 1146
5 SASI_Rn01_00060140 predicted 1045
6 SASI_Rn01_00060142 predicted 1021
7 SASI_Rn01_00060143 predicted 435
8 SASI_Rn01_00060144 predicted 877
9 SASI_Rn02_00264207 predicted 1149
10 SASI_Rn02_00264208 predicted 1049
11 SASI_Rn01_00060135 predicted 843
12 SASI_Rn01_00060138 predicted 673
13 SASI_Rn01_00060141 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045653 predicted 418
2 SASI_Mm01_00045654 predicted 455
3 SASI_Mm01_00045655 predicted 1141
4 SASI_Mm01_00045656 predicted 203
5 SASI_Mm01_00045657 predicted 630
6 SASI_Mm01_00045658 predicted 256
7 SASI_Mm01_00045659 predicted 701
8 SASI_Mm01_00045660 predicted 984
9 SASI_Mm02_00311876 predicted 1597
10 SASI_Mm01_00045661 predicted 259
11 SASI_Mm01_00045652 predicted 803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001708
OPN1SW MISSION shRNA Bacterial Glycerol Stock
opsin 1 (cone pigments), short-wave-sensitive
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-467s21c1
Sequence:CCGGCTACCTGGACCATTGGTATTGCTCGAGCAATACCAATGGTCCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-121s21c1
Sequence:CCGGATGGGCACTGTCTTCCTTATACTCGAGTATAAGGAAGACAGTGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-582s21c1
Sequence:CCGGATACCGCAGCGAGTCCTATACCTCGAGGTATAGGACTCGCTGCGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-65s21c1
Sequence:CCGGATGGGCCTCAGTACCACATTGCTCGAGCAATGTGGTACTGAGGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-811s1c1
Sequence:CCGGCGCCATGTACATGGTCAACAACTCGAGTTGTTGACCATGTACATGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-400s1c1
Sequence:CCGGGCGCTACATTGTCATCTGTAACTCGAGTTACAGATGACAATGTAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-877s1c1
Sequence:CCGGCTTCTCCAAGAGTGCTTGCATCTCGAGATGCAAGCACTCTTGGAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-348s1c1
Sequence:CCGGGCACTGTAGCAGGTCTGGTTACTCGAGTAACCAGACCTGCTACAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-211s1c1
Sequence:CCGGCCTCAACTACATTCTGGTCAACTCGAGTTGACCAGAATGTAGTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001708
OPN1SW MISSION shRNA shRNA Plasmid DNA
opsin 1 (cone pigments), short-wave-sensitive
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-467s21c1
Sequence:CCGGCTACCTGGACCATTGGTATTGCTCGAGCAATACCAATGGTCCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-121s21c1
Sequence:CCGGATGGGCACTGTCTTCCTTATACTCGAGTATAAGGAAGACAGTGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-582s21c1
Sequence:CCGGATACCGCAGCGAGTCCTATACCTCGAGGTATAGGACTCGCTGCGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-65s21c1
Sequence:CCGGATGGGCCTCAGTACCACATTGCTCGAGCAATGTGGTACTGAGGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-811s1c1
Sequence:CCGGCGCCATGTACATGGTCAACAACTCGAGTTGTTGACCATGTACATGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-400s1c1
Sequence:CCGGGCGCTACATTGTCATCTGTAACTCGAGTTACAGATGACAATGTAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-877s1c1
Sequence:CCGGCTTCTCCAAGAGTGCTTGCATCTCGAGATGCAAGCACTCTTGGAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-348s1c1
Sequence:CCGGGCACTGTAGCAGGTCTGGTTACTCGAGTAACCAGACCTGCTACAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-211s1c1
Sequence:CCGGCCTCAACTACATTCTGGTCAACTCGAGTTGACCAGAATGTAGTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001708
OPN1SW MISSION shRNA Lentiviral Transduction Particles
opsin 1 (cone pigments), short-wave-sensitive
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-467s21c1
Sequence:CCGGCTACCTGGACCATTGGTATTGCTCGAGCAATACCAATGGTCCAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-121s21c1
Sequence:CCGGATGGGCACTGTCTTCCTTATACTCGAGTATAAGGAAGACAGTGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-582s21c1
Sequence:CCGGATACCGCAGCGAGTCCTATACCTCGAGGTATAGGACTCGCTGCGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001708.2-65s21c1
Sequence:CCGGATGGGCCTCAGTACCACATTGCTCGAGCAATGTGGTACTGAGGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-811s1c1
Sequence:CCGGCGCCATGTACATGGTCAACAACTCGAGTTGTTGACCATGTACATGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-400s1c1
Sequence:CCGGGCGCTACATTGTCATCTGTAACTCGAGTTACAGATGACAATGTAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-877s1c1
Sequence:CCGGCTTCTCCAAGAGTGCTTGCATCTCGAGATGCAAGCACTCTTGGAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-348s1c1
Sequence:CCGGGCACTGTAGCAGGTCTGGTTACTCGAGTAACCAGACCTGCTACAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001708.1-211s1c1
Sequence:CCGGCCTCAACTACATTCTGGTCAACTCGAGTTGACCAGAATGTAGTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007538
OPN1SW MISSION shRNA Bacterial Glycerol Stock
opsin 1 (cone pigments), short-wave-sensitive
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-864s1c1
Sequence:CCGGGCCATGTACATGGTCAACAATCTCGAGATTGTTGACCATGTACATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-458s1c1
Sequence:CCGGCGTTGTCATCTGTAAACCCTTCTCGAGAAGGGTTTACAGATGACAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-968s1c1
Sequence:CCGGCTGCTTCATGAATAAGCAGTTCTCGAGAACTGCTTATTCATGAAGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-419s1c1
Sequence:CCGGGACAGGATGGTCATTGGCTTTCTCGAGAAAGCCAATGACCATCCTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-345s1c1
Sequence:CCGGTGTCACGGATACTTCCTCTTTCTCGAGAAAGAGGAAGTATCCGTGACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007538
OPN1SW MISSION shRNA shRNA Plasmid DNA
opsin 1 (cone pigments), short-wave-sensitive
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-864s1c1
Sequence:CCGGGCCATGTACATGGTCAACAATCTCGAGATTGTTGACCATGTACATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-458s1c1
Sequence:CCGGCGTTGTCATCTGTAAACCCTTCTCGAGAAGGGTTTACAGATGACAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-968s1c1
Sequence:CCGGCTGCTTCATGAATAAGCAGTTCTCGAGAACTGCTTATTCATGAAGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-419s1c1
Sequence:CCGGGACAGGATGGTCATTGGCTTTCTCGAGAAAGCCAATGACCATCCTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-345s1c1
Sequence:CCGGTGTCACGGATACTTCCTCTTTCTCGAGAAAGAGGAAGTATCCGTGACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007538
OPN1SW MISSION shRNA Lentiviral Transduction Particles
opsin 1 (cone pigments), short-wave-sensitive
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-864s1c1
Sequence:CCGGGCCATGTACATGGTCAACAATCTCGAGATTGTTGACCATGTACATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-458s1c1
Sequence:CCGGCGTTGTCATCTGTAAACCCTTCTCGAGAAGGGTTTACAGATGACAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-968s1c1
Sequence:CCGGCTGCTTCATGAATAAGCAGTTCTCGAGAACTGCTTATTCATGAAGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-419s1c1
Sequence:CCGGGACAGGATGGTCATTGGCTTTCTCGAGAAAGCCAATGACCATCCTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007538.2-345s1c1
Sequence:CCGGTGTCACGGATACTTCCTCTTTCTCGAGAAAGAGGAAGTATCCGTGACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)