EMAIL THIS PAGE TO A FRIEND

OPN3

opsin 3

117 Gene Product Result for
Synonyms: ECPN
UniProtKB ID: Q9H1Y3, Q8IX08, Q9Y344
Gene ID:
Human(23596) Summary: Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. In addition to the visual opsins, mammals possess several photoreceptive non-visual opsins that are expressed in extraocular tissues. This gene, opsin 3, is strongly expressed in brain and testis and weakly expressed in liver, placenta, heart, lung, skeletal muscle, kidney, and pancreas. The gene may also be expressed in the retina. The protein has the canonical features of a photoreceptive opsin protein. [provided by RefSeq, Jul 2008]
Mouse(13603) opsin 3
Rat(498289) opsin 3
cow(100847752) opsin 3
dog(611646) opsin 3
chicken(428582) opsin 3
cow(100138537) opsin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014322 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030011 Rosetta Predictions human pricing
NM_001030012 Rosetta Predictions human pricing
NM_014322 Rosetta Predictions human pricing
XM_573517 Rosetta Predictions rat pricing
XR_007707 Rosetta Predictions rat pricing
NM_010098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060034 predicted 1016
2 SASI_Hs01_00060035 predicted 868
3 SASI_Hs01_00060036 predicted 969
4 SASI_Hs01_00060037 predicted 1062
5 SASI_Hs01_00060038 predicted 992
6 SASI_Hs01_00060039 predicted 956
7 SASI_Hs01_00060040 predicted 746
8 SASI_Hs01_00060041 predicted 730
9 SASI_Hs01_00060042 predicted 684
10 SASI_Hs01_00060043 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155639 predicted 1183
2 SASI_Hs01_00155640 predicted 1031
3 SASI_Hs01_00155641 predicted 1131
4 SASI_Hs01_00155642 predicted 1162
5 SASI_Hs01_00155643 predicted 1109
6 SASI_Hs01_00155644 predicted 901
7 SASI_Hs01_00155645 predicted 891
8 SASI_Hs01_00155646 predicted 849
9 SASI_Hs01_00155647 predicted 854
10 SASI_Hs01_00155648 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345429 predicted 1003
2 SASI_Hs02_00345430 predicted 1003
3 SASI_Hs01_00180308 predicted 1182
4 SASI_Hs02_00345431 predicted 671
5 SASI_Hs02_00345432 predicted 790
6 SASI_Hs02_00345433 predicted 1187
7 SASI_Hs02_00345434 predicted 806
8 SASI_Hs02_00345435 predicted 969
9 SASI_Hs02_00345436 predicted 495
10 SASI_Hs02_00345437 predicted 614
11 SASI_Hs01_00180307 predicted 1337
12 SASI_Hs01_00180309 predicted 1291
13 SASI_Hs01_00180310 predicted 1431
14 SASI_Hs01_00180311 predicted 1382
15 SASI_Hs01_00180312 predicted 1313
16 SASI_Hs01_00180313 predicted 1494
17 SASI_Hs01_00180314 predicted 1507
18 SASI_Hs01_00180315 predicted 1465
19 SASI_Hs01_00180316 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400434 predicted 1534
2 SASI_Rn02_00400435 predicted 1260
3 SASI_Rn02_00400436 predicted 1449
4 SASI_Rn02_00400437 predicted 1455
5 SASI_Rn02_00400438 predicted 1354
6 SASI_Rn02_00400439 predicted 1530
7 SASI_Rn02_00400440 predicted 1282
8 SASI_Rn02_00400441 predicted 1251
9 SASI_Rn02_00400442 predicted 1291
10 SASI_Rn02_00400443 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00415255 predicted 228
2 SASI_Rn02_00415256 predicted 522
3 SASI_Rn02_00415257 predicted 361
4 SASI_Rn02_00415258 predicted 502
5 SASI_Rn02_00415259 predicted 442
6 SASI_Rn02_00415260 predicted 535
7 SASI_Rn02_00415261 predicted 235
8 SASI_Rn02_00415262 predicted 404
9 SASI_Rn02_00415263 predicted 386
10 SASI_Rn02_00415264 predicted 233
11 SASI_Rn01_00136959 predicted 1420
12 SASI_Rn01_00136960 predicted 1143
13 SASI_Rn01_00136961 predicted 1330
14 SASI_Rn01_00136962 predicted 1342
15 SASI_Rn01_00136963 predicted 1240
16 SASI_Rn01_00136964 predicted 1413
17 SASI_Rn01_00136965 predicted 1168
18 SASI_Rn01_00136966 predicted 1134
19 SASI_Rn01_00136967 predicted 1169
20 SASI_Rn01_00136968 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098480 predicted 447
2 SASI_Mm01_00098481 predicted 1145
3 SASI_Mm01_00098483 predicted 945
4 SASI_Mm01_00098484 predicted 1138
5 SASI_Mm01_00098485 predicted 852
6 SASI_Mm02_00317800 predicted 685
7 SASI_Mm01_00098486 predicted 1280
8 SASI_Mm01_00098487 predicted 766
9 SASI_Mm01_00098488 predicted 1216
10 SASI_Mm01_00098489 predicted 394
11 SASI_Mm01_00098482 predicted 1278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014322
OPN3 MISSION shRNA Bacterial Glycerol Stock
opsin 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-422s1c1
Sequence:CCGGCTCTTCGGGATTGTTTCCATTCTCGAGAATGGAAACAATCCCGAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014322.1-1470s1c1
Sequence:CCGGCGGGTGCTTTACATAATGAAACTCGAGTTTCATTATGTAAAGCACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-940s21c1
Sequence:CCGGGGTCTGTTGGATGCCTTATATCTCGAGATATAAGGCATCCAACAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-1024s21c1
Sequence:CCGGTTCGTACCTCTTTGCTAAATCCTCGAGGATTTAGCAAAGAGGTACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-983s1c1
Sequence:CCGGGTCTTCATGATCAGAAAGTTTCTCGAGAAACTTTCTGATCATGAAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-862s1c1
Sequence:CCGGGCCTTATATCGTGATCTGCTTCTCGAGAAGCAGATCACGATATAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-641s1c1
Sequence:CCGGGATGCCAACGATTCCTCCTTTCTCGAGAAAGGAGGAATCGTTGGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-807s21c1
Sequence:CCGGGCTATGGCCATATTCTATATTCTCGAGAATATAGAATATGGCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-576s21c1
Sequence:CCGGTCCATGCCAGAGTGATCAATTCTCGAGAATTGATCACTCTGGCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014322
OPN3 MISSION shRNA shRNA Plasmid DNA
opsin 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-422s1c1
Sequence:CCGGCTCTTCGGGATTGTTTCCATTCTCGAGAATGGAAACAATCCCGAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014322.1-1470s1c1
Sequence:CCGGCGGGTGCTTTACATAATGAAACTCGAGTTTCATTATGTAAAGCACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-940s21c1
Sequence:CCGGGGTCTGTTGGATGCCTTATATCTCGAGATATAAGGCATCCAACAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-1024s21c1
Sequence:CCGGTTCGTACCTCTTTGCTAAATCCTCGAGGATTTAGCAAAGAGGTACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-983s1c1
Sequence:CCGGGTCTTCATGATCAGAAAGTTTCTCGAGAAACTTTCTGATCATGAAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-862s1c1
Sequence:CCGGGCCTTATATCGTGATCTGCTTCTCGAGAAGCAGATCACGATATAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-641s1c1
Sequence:CCGGGATGCCAACGATTCCTCCTTTCTCGAGAAAGGAGGAATCGTTGGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-807s21c1
Sequence:CCGGGCTATGGCCATATTCTATATTCTCGAGAATATAGAATATGGCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-576s21c1
Sequence:CCGGTCCATGCCAGAGTGATCAATTCTCGAGAATTGATCACTCTGGCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014322
OPN3 MISSION shRNA Lentiviral Transduction Particles
opsin 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-422s1c1
Sequence:CCGGCTCTTCGGGATTGTTTCCATTCTCGAGAATGGAAACAATCCCGAAGAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014322.1-1470s1c1
Sequence:CCGGCGGGTGCTTTACATAATGAAACTCGAGTTTCATTATGTAAAGCACCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-940s21c1
Sequence:CCGGGGTCTGTTGGATGCCTTATATCTCGAGATATAAGGCATCCAACAGACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-1024s21c1
Sequence:CCGGTTCGTACCTCTTTGCTAAATCCTCGAGGATTTAGCAAAGAGGTACGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000011781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-983s1c1
Sequence:CCGGGTCTTCATGATCAGAAAGTTTCTCGAGAAACTTTCTGATCATGAAGACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-862s1c1
Sequence:CCGGGCCTTATATCGTGATCTGCTTCTCGAGAAGCAGATCACGATATAAGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014322.1-641s1c1
Sequence:CCGGGATGCCAACGATTCCTCCTTTCTCGAGAAAGGAGGAATCGTTGGCATCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-807s21c1
Sequence:CCGGGCTATGGCCATATTCTATATTCTCGAGAATATAGAATATGGCCATAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014322.2-576s21c1
Sequence:CCGGTCCATGCCAGAGTGATCAATTCTCGAGAATTGATCACTCTGGCATGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010098
VALIDATED
OPN3 MISSION shRNA Bacterial Glycerol Stock
opsin 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-450s21c1
Sequence:CCGGGCTGGCCTATGAACGTTATATCTCGAGATATAACGTTCATAGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-519s1c1
Sequence:CCGGCATTACCTATATCTGGCTCTACTCGAGTAGAGCCAGATATAGGTAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-1402s1c1
Sequence:CCGGCGACTGAGCAAGACAAATTATCTCGAGATAATTTGTCTTGCTCAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-410s1c1
Sequence:CCGGGCAGCCTCTTTGGGTTCGTTTCTCGAGAAACGAACCCAAAGAGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-1218s1c1
Sequence:CCGGCGCATCTAAGGTCGATGTCATCTCGAGATGACATCGACCTTAGATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-578s21c1
Sequence:CCGGACAGGTACATCCTAGACATACCTCGAGGTATGTCTAGGATGTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-1207s21c1
Sequence:CCGGGACAGAAGCAGCGCATCTAAGCTCGAGCTTAGATGCGCTGCTTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-510s21c1
Sequence:CCGGCTGGAGGGCCATTACCTATATCTCGAGATATAGGTAATGGCCCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010098.2-1260s21c1
Sequence:CCGGATGGAAGACAGAGTCCTATATCTCGAGATATAGGACTCTGTCTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010098
VALIDATED
OPN3 MISSION shRNA shRNA Plasmid DNA
opsin 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-450s21c1
Sequence:CCGGGCTGGCCTATGAACGTTATATCTCGAGATATAACGTTCATAGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-519s1c1
Sequence:CCGGCATTACCTATATCTGGCTCTACTCGAGTAGAGCCAGATATAGGTAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-1402s1c1
Sequence:CCGGCGACTGAGCAAGACAAATTATCTCGAGATAATTTGTCTTGCTCAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-410s1c1
Sequence:CCGGGCAGCCTCTTTGGGTTCGTTTCTCGAGAAACGAACCCAAAGAGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-1218s1c1
Sequence:CCGGCGCATCTAAGGTCGATGTCATCTCGAGATGACATCGACCTTAGATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-578s21c1
Sequence:CCGGACAGGTACATCCTAGACATACCTCGAGGTATGTCTAGGATGTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-1207s21c1
Sequence:CCGGGACAGAAGCAGCGCATCTAAGCTCGAGCTTAGATGCGCTGCTTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-510s21c1
Sequence:CCGGCTGGAGGGCCATTACCTATATCTCGAGATATAGGTAATGGCCCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010098.2-1260s21c1
Sequence:CCGGATGGAAGACAGAGTCCTATATCTCGAGATATAGGACTCTGTCTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010098
VALIDATED
OPN3 MISSION shRNA Lentiviral Transduction Particles
opsin 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-450s21c1
Sequence:CCGGGCTGGCCTATGAACGTTATATCTCGAGATATAACGTTCATAGGCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000028313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-519s1c1
Sequence:CCGGCATTACCTATATCTGGCTCTACTCGAGTAGAGCCAGATATAGGTAATGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000028305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-1402s1c1
Sequence:CCGGCGACTGAGCAAGACAAATTATCTCGAGATAATTTGTCTTGCTCAGTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000028324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-410s1c1
Sequence:CCGGGCAGCCTCTTTGGGTTCGTTTCTCGAGAAACGAACCCAAAGAGGCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000028389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010098.1-1218s1c1
Sequence:CCGGCGCATCTAAGGTCGATGTCATCTCGAGATGACATCGACCTTAGATGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-578s21c1
Sequence:CCGGACAGGTACATCCTAGACATACCTCGAGGTATGTCTAGGATGTACCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-1207s21c1
Sequence:CCGGGACAGAAGCAGCGCATCTAAGCTCGAGCTTAGATGCGCTGCTTCTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010098.2-510s21c1
Sequence:CCGGCTGGAGGGCCATTACCTATATCTCGAGATATAGGTAATGGCCCTCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010098.2-1260s21c1
Sequence:CCGGATGGAAGACAGAGTCCTATATCTCGAGATATAGGACTCTGTCTTCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???