EMAIL THIS PAGE TO A FRIEND

OPN4

opsin 4

86 Gene Product Result for
Synonyms: MOP
UniProtKB ID: Q9UHM6, B7ZLB3, Q14D01, Q2PP22, Q8NGQ9
Gene ID:
Human(94233) Summary: Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. This gene encodes a photoreceptive opsin protein that is expressed within the ganglion and amacrine cell layers of the retina. In mouse, retinal ganglion cell axons expressing this gene projected to the suprachiasmatic nucleus and other brain nuclei involved in circadian photoentrainment. In mouse, this protein is coupled to a transient receptor potential (TRP) ion channel through a G protein signaling pathway and produces a physiologic light response via membrane depolarization and increased intracellular calcium. The protein functions as a sensory photopigment and may also have photoisomerase activity. Experiments with knockout mice indicate that this gene attenuates, but does not abolish, photoentrainment. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(30044) opsin 4 (melanopsin)
Rat(192223) opsin 4
chicken(423609) opsin 4
dog(611027) opsin 4
cow(515152) opsin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030015 Rosetta Predictions human pricing
NM_033282 Rosetta Predictions human pricing
NM_138860 Rosetta Predictions rat pricing
NM_001128599 Rosetta Predictions mouse pricing
NM_013887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041137 predicted 1772
2 SASI_Hs01_00041138 predicted 1743
3 SASI_Hs01_00041140 predicted 966
4 SASI_Hs01_00041141 predicted 834
5 SASI_Hs01_00041142 predicted 2029
6 SASI_Hs01_00041143 predicted 2034
7 SASI_Hs01_00041144 predicted 800
8 SASI_Hs01_00041145 predicted 952
9 SASI_Hs01_00041146 predicted 1205
10 SASI_Hs02_00307630 predicted 1074
11 SASI_Hs01_00041139 predicted 2023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114446 predicted 1739
2 SASI_Hs01_00114447 predicted 1705
3 SASI_Hs01_00114449 predicted 931
4 SASI_Hs01_00114450 predicted 797
5 SASI_Hs01_00114451 predicted 1996
6 SASI_Hs01_00114452 predicted 2000
7 SASI_Hs01_00114453 predicted 772
8 SASI_Hs01_00114454 predicted 916
9 SASI_Hs01_00114455 predicted 1178
10 SASI_Hs02_00361088 predicted 1041
11 SASI_Hs01_00114448 predicted 1984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041145 predicted 616
2 SASI_Rn01_00041146 predicted 1077
3 SASI_Rn01_00041147 predicted 1657
4 SASI_Rn01_00041148 predicted 755
5 SASI_Rn01_00041149 predicted 1679
6 SASI_Rn01_00041150 predicted 1252
7 SASI_Rn01_00041151 predicted 1767
8 SASI_Rn01_00041152 predicted 1664
9 SASI_Rn01_00041153 predicted 1735
10 SASI_Rn01_00041154 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310688 predicted 739
2 SASI_Mm02_00310689 predicted 674
3 SASI_Mm02_00310690 predicted 790
4 SASI_Mm02_00310691 predicted 269
5 SASI_Mm02_00310692 predicted 879
6 SASI_Mm02_00310693 predicted 604
7 SASI_Mm02_00310694 predicted 227
8 SASI_Mm02_00310695 predicted 256
9 SASI_Mm02_00310696 predicted 979
10 SASI_Mm02_00310697 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322925 predicted 741
2 SASI_Mm02_00322926 predicted 668
3 SASI_Mm02_00322927 predicted 783
4 SASI_Mm02_00322928 predicted 276
5 SASI_Mm02_00322929 predicted 876
6 SASI_Mm02_00322930 predicted 600
7 SASI_Mm02_00322931 predicted 226
8 SASI_Mm02_00322932 predicted 256
9 SASI_Mm02_00322933 predicted 974
10 SASI_Mm02_00322934 predicted 672
11 SASI_Mm01_00041574 predicted 492
12 SASI_Mm01_00041575 predicted 1831
13 SASI_Mm01_00041576 predicted 1832
14 SASI_Mm01_00041577 predicted 440
15 SASI_Mm01_00041578 predicted 1761
16 SASI_Mm01_00041579 predicted 1209
17 SASI_Mm01_00041580 predicted 329
18 SASI_Mm01_00041581 predicted 1718
19 SASI_Mm01_00041582 predicted 259
20 SASI_Mm01_00041583 predicted 1241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033282
OPN4 MISSION shRNA Bacterial Glycerol Stock
opsin 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033282.3-609s21c1
Sequence:CCGGTTCACCAGTAGCCTCTATAAGCTCGAGCTTATAGAGGCTACTGGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033282.3-487s21c1
Sequence:CCGGGCAACCTGACGGTCATCTATACTCGAGTATAGATGACCGTCAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033282.3-2003s21c1
Sequence:CCGGAGAGAACACACCAGCTATTTACTCGAGTAAATAGCTGGTGTGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033282.1-1917s1c1
Sequence:CCGGCCAGAGAACACACCAGCTATTCTCGAGAATAGCTGGTGTGTTCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-407s1c1
Sequence:CCGGCCTGACGGTCATCTATACCTTCTCGAGAAGGTATAGATGACCGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-536s1c1
Sequence:CCGGCCTCTATAAGCAGTGGCTCTTCTCGAGAAGAGCCACTGCTTATAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-896s1c1
Sequence:CCGGCATCTACTGCTACATCTTCATCTCGAGATGAAGATGTAGCAGTAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-524s1c1
Sequence:CCGGCTTCACCAGTAGCCTCTATAACTCGAGTTATAGAGGCTACTGGTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033282
OPN4 MISSION shRNA shRNA Plasmid DNA
opsin 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033282.3-609s21c1
Sequence:CCGGTTCACCAGTAGCCTCTATAAGCTCGAGCTTATAGAGGCTACTGGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033282.3-487s21c1
Sequence:CCGGGCAACCTGACGGTCATCTATACTCGAGTATAGATGACCGTCAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033282.3-2003s21c1
Sequence:CCGGAGAGAACACACCAGCTATTTACTCGAGTAAATAGCTGGTGTGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033282.1-1917s1c1
Sequence:CCGGCCAGAGAACACACCAGCTATTCTCGAGAATAGCTGGTGTGTTCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-407s1c1
Sequence:CCGGCCTGACGGTCATCTATACCTTCTCGAGAAGGTATAGATGACCGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-536s1c1
Sequence:CCGGCCTCTATAAGCAGTGGCTCTTCTCGAGAAGAGCCACTGCTTATAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-896s1c1
Sequence:CCGGCATCTACTGCTACATCTTCATCTCGAGATGAAGATGTAGCAGTAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-524s1c1
Sequence:CCGGCTTCACCAGTAGCCTCTATAACTCGAGTTATAGAGGCTACTGGTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033282
OPN4 MISSION shRNA Lentiviral Transduction Particles
opsin 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033282.3-609s21c1
Sequence:CCGGTTCACCAGTAGCCTCTATAAGCTCGAGCTTATAGAGGCTACTGGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033282.3-487s21c1
Sequence:CCGGGCAACCTGACGGTCATCTATACTCGAGTATAGATGACCGTCAGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033282.3-2003s21c1
Sequence:CCGGAGAGAACACACCAGCTATTTACTCGAGTAAATAGCTGGTGTGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033282.1-1917s1c1
Sequence:CCGGCCAGAGAACACACCAGCTATTCTCGAGAATAGCTGGTGTGTTCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-407s1c1
Sequence:CCGGCCTGACGGTCATCTATACCTTCTCGAGAAGGTATAGATGACCGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-536s1c1
Sequence:CCGGCCTCTATAAGCAGTGGCTCTTCTCGAGAAGAGCCACTGCTTATAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-896s1c1
Sequence:CCGGCATCTACTGCTACATCTTCATCTCGAGATGAAGATGTAGCAGTAGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033282.1-524s1c1
Sequence:CCGGCTTCACCAGTAGCCTCTATAACTCGAGTTATAGAGGCTACTGGTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013887
OPN4 MISSION shRNA Bacterial Glycerol Stock
opsin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-575s1c1
Sequence:CCGGCTCTACAAGAAGTGGCTCTTTCTCGAGAAAGAGCCACTTCTTGTAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-791s1c1
Sequence:CCGGCCACCTTTCTTTGGTTGGAGTCTCGAGACTCCAACCAAAGAAAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-1507s1c1
Sequence:CCGGCCTAGAAGATGGAGAACTCAACTCGAGTTGAGTTCTCCATCTTCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-637s1c1
Sequence:CCGGCTTTGGCATCACTTCCATGATCTCGAGATCATGGAAGTGATGCCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-1064s1c1
Sequence:CCGGGTCGCACTGATTGTCATTCTTCTCGAGAAGAATGACAATCAGTGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013887
OPN4 MISSION shRNA shRNA Plasmid DNA
opsin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-575s1c1
Sequence:CCGGCTCTACAAGAAGTGGCTCTTTCTCGAGAAAGAGCCACTTCTTGTAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-791s1c1
Sequence:CCGGCCACCTTTCTTTGGTTGGAGTCTCGAGACTCCAACCAAAGAAAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-1507s1c1
Sequence:CCGGCCTAGAAGATGGAGAACTCAACTCGAGTTGAGTTCTCCATCTTCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-637s1c1
Sequence:CCGGCTTTGGCATCACTTCCATGATCTCGAGATCATGGAAGTGATGCCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-1064s1c1
Sequence:CCGGGTCGCACTGATTGTCATTCTTCTCGAGAAGAATGACAATCAGTGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013887
OPN4 MISSION shRNA Lentiviral Transduction Particles
opsin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-575s1c1
Sequence:CCGGCTCTACAAGAAGTGGCTCTTTCTCGAGAAAGAGCCACTTCTTGTAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-791s1c1
Sequence:CCGGCCACCTTTCTTTGGTTGGAGTCTCGAGACTCCAACCAAAGAAAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-1507s1c1
Sequence:CCGGCCTAGAAGATGGAGAACTCAACTCGAGTTGAGTTCTCCATCTTCTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-637s1c1
Sequence:CCGGCTTTGGCATCACTTCCATGATCTCGAGATCATGGAAGTGATGCCAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013887.1-1064s1c1
Sequence:CCGGGTCGCACTGATTGTCATTCTTCTCGAGAAGAATGACAATCAGTGCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)