EMAIL THIS PAGE TO A FRIEND

OPN5

opsin 5

99 Gene Product Result for
Synonyms: GPR136 PGR12 TMEM13
UniProtKB ID: Q6U736, A0AV33, Q5T5B9, Q5T886, Q7Z603, Q86SL5
Gene ID:
Human(221391) Summary: Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. This opsin gene is expressed in the eye, brain, testes, and spinal cord. This gene belongs to the seven-exon subfamily of mammalian opsin genes that includes peropsin (RRH) and retinal G protein coupled receptor (RGR). Like these other seven-exon opsin genes, this family member may encode a protein with photoisomerase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Mouse(353344) opsin 5
Rat(316259) opsin 5
cow(541280) opsin 5
dog(481828) opsin 5
chicken(428670) opsin 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181744 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030051 Rosetta Predictions human pricing
NM_181744 Rosetta Predictions human pricing
NM_181772 Rosetta Predictions rat pricing
NM_181753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242091 predicted 937
2 SASI_Hs01_00242092 predicted 686
3 SASI_Hs01_00242093 predicted 892
4 SASI_Hs01_00242094 predicted 779
5 SASI_Hs01_00242095 predicted 726
6 SASI_Hs01_00242096 predicted 671
7 SASI_Hs01_00242097 predicted 929
8 SASI_Hs01_00242098 predicted 938
9 SASI_Hs01_00242099 predicted 1330
10 SASI_Hs01_00242100 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146652 predicted 954
2 SASI_Hs01_00146653 predicted 705
3 SASI_Hs01_00146654 predicted 910
4 SASI_Hs01_00146655 predicted 800
5 SASI_Hs01_00146656 predicted 749
6 SASI_Hs01_00146657 predicted 682
7 SASI_Hs01_00146658 predicted 943
8 SASI_Hs01_00146659 predicted 963
9 SASI_Hs01_00146660 predicted 1346
10 SASI_Hs01_00146661 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040396 predicted 815
2 SASI_Rn02_00269804 predicted 1269
3 SASI_Rn01_00040397 predicted 1301
4 SASI_Rn01_00040398 predicted 439
5 SASI_Rn01_00040399 predicted 699
6 SASI_Rn01_00040400 predicted 382
7 SASI_Rn01_00040401 predicted 1139
8 SASI_Rn01_00040402 predicted 1222
9 SASI_Rn01_00040403 predicted 902
10 SASI_Rn02_00269805 predicted 1080
11 SASI_Rn01_00040404 predicted 838
12 SASI_Rn01_00040405 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027753 predicted 701
2 SASI_Mm01_00027754 predicted 447
3 SASI_Mm01_00027755 predicted 909
4 SASI_Mm01_00027756 predicted 394
5 SASI_Mm01_00027757 predicted 954
6 SASI_Mm01_00027758 predicted 891
7 SASI_Mm01_00027759 predicted 463
8 SASI_Mm01_00027760 predicted 220
9 SASI_Mm01_00027762 predicted 300
10 SASI_Mm02_00349922 predicted 787
11 SASI_Mm01_00027761 predicted 800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181753
OPN5 MISSION shRNA Bacterial Glycerol Stock
opsin 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000026854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-269s1c1
Sequence:CCGGGTTCACCATCATCTCTTGCTTCTCGAGAAGCAAGAGATGATGGTGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-396s1c1
Sequence:CCGGCGCTATCTGAAGATCTGTTATCTCGAGATAACAGATCTTCAGATAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-690s1c1
Sequence:CCGGTCTTCTAAAGAGGTAGCCCATCTCGAGATGGGCTACCTCTTTAGAAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-207s1c1
Sequence:CCGGGCGGAAATAATGACTATCAATCTCGAGATTGATAGTCATTATTTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181753
OPN5 MISSION shRNA shRNA Plasmid DNA
opsin 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000026854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-269s1c1
Sequence:CCGGGTTCACCATCATCTCTTGCTTCTCGAGAAGCAAGAGATGATGGTGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-396s1c1
Sequence:CCGGCGCTATCTGAAGATCTGTTATCTCGAGATAACAGATCTTCAGATAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-690s1c1
Sequence:CCGGTCTTCTAAAGAGGTAGCCCATCTCGAGATGGGCTACCTCTTTAGAAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-207s1c1
Sequence:CCGGGCGGAAATAATGACTATCAATCTCGAGATTGATAGTCATTATTTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181753
OPN5 MISSION shRNA Lentiviral Transduction Particles
opsin 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000026854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-269s1c1
Sequence:CCGGGTTCACCATCATCTCTTGCTTCTCGAGAAGCAAGAGATGATGGTGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-396s1c1
Sequence:CCGGCGCTATCTGAAGATCTGTTATCTCGAGATAACAGATCTTCAGATAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-690s1c1
Sequence:CCGGTCTTCTAAAGAGGTAGCCCATCTCGAGATGGGCTACCTCTTTAGAAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181753.2-207s1c1
Sequence:CCGGGCGGAAATAATGACTATCAATCTCGAGATTGATAGTCATTATTTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181744
OPN5 MISSION shRNA Bacterial Glycerol Stock
opsin 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-99s1c1
Sequence:CCGGGCGGATTTAGTGGCTGGCTTTCTCGAGAAAGCCAGCCACTAAATCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-691s1c1
Sequence:CCGGCTTCCAAAGAAGTAGCTCATTCTCGAGAATGAGCTACTTCTTTGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-740s1c1
Sequence:CCGGGCTGGAAATGAAACTGACAAACTCGAGTTTGTCAGTTTCATTTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-206s1c1
Sequence:CCGGCGCTGAAATAATGACTATCAACTCGAGTTGATAGTCATTATTTCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181744.1-1127s1c1
Sequence:CCGGGCAGAGAAATTAGCTTACAAACTCGAGTTTGTAAGCTAATTTCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181744.2-383s21c1
Sequence:CCGGTGTCAGCCTGGATCGATATTTCTCGAGAAATATCGATCCAGGCTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181744.2-1303s21c1
Sequence:CCGGTGCCAGAAACCCACGCTTTAACTCGAGTTAAAGCGTGGGTTTCTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181744.2-647s21c1
Sequence:CCGGGATCGTGTTCTCCTACGTAAACTCGAGTTTACGTAGGAGAACACGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181744.2-912s21c1
Sequence:CCGGCCCATCATTTACCAAGTTATTCTCGAGAATAACTTGGTAAATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181744
OPN5 MISSION shRNA shRNA Plasmid DNA
opsin 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-99s1c1
Sequence:CCGGGCGGATTTAGTGGCTGGCTTTCTCGAGAAAGCCAGCCACTAAATCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-691s1c1
Sequence:CCGGCTTCCAAAGAAGTAGCTCATTCTCGAGAATGAGCTACTTCTTTGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-740s1c1
Sequence:CCGGGCTGGAAATGAAACTGACAAACTCGAGTTTGTCAGTTTCATTTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-206s1c1
Sequence:CCGGCGCTGAAATAATGACTATCAACTCGAGTTGATAGTCATTATTTCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181744.1-1127s1c1
Sequence:CCGGGCAGAGAAATTAGCTTACAAACTCGAGTTTGTAAGCTAATTTCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181744.2-383s21c1
Sequence:CCGGTGTCAGCCTGGATCGATATTTCTCGAGAAATATCGATCCAGGCTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181744.2-1303s21c1
Sequence:CCGGTGCCAGAAACCCACGCTTTAACTCGAGTTAAAGCGTGGGTTTCTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181744.2-647s21c1
Sequence:CCGGGATCGTGTTCTCCTACGTAAACTCGAGTTTACGTAGGAGAACACGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181744.2-912s21c1
Sequence:CCGGCCCATCATTTACCAAGTTATTCTCGAGAATAACTTGGTAAATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181744
OPN5 MISSION shRNA Lentiviral Transduction Particles
opsin 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-99s1c1
Sequence:CCGGGCGGATTTAGTGGCTGGCTTTCTCGAGAAAGCCAGCCACTAAATCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-691s1c1
Sequence:CCGGCTTCCAAAGAAGTAGCTCATTCTCGAGAATGAGCTACTTCTTTGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-740s1c1
Sequence:CCGGGCTGGAAATGAAACTGACAAACTCGAGTTTGTCAGTTTCATTTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181744.1-206s1c1
Sequence:CCGGCGCTGAAATAATGACTATCAACTCGAGTTGATAGTCATTATTTCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181744.1-1127s1c1
Sequence:CCGGGCAGAGAAATTAGCTTACAAACTCGAGTTTGTAAGCTAATTTCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181744.2-383s21c1
Sequence:CCGGTGTCAGCCTGGATCGATATTTCTCGAGAAATATCGATCCAGGCTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181744.2-1303s21c1
Sequence:CCGGTGCCAGAAACCCACGCTTTAACTCGAGTTAAAGCGTGGGTTTCTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181744.2-647s21c1
Sequence:CCGGGATCGTGTTCTCCTACGTAAACTCGAGTTTACGTAGGAGAACACGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181744.2-912s21c1
Sequence:CCGGCCCATCATTTACCAAGTTATTCTCGAGAATAACTTGGTAAATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)