EMAIL THIS PAGE TO A FRIEND

OPRD1

opioid receptor, delta 1

80 Gene Product Result for
Synonyms: OPRD
UniProtKB ID: P41143, B5B0B8
Gene ID:
Mouse(18386) opioid receptor, delta 1
Rat(24613) opioid receptor, delta 1
chicken(429951) opioid receptor, delta 1
dog(487329) opioid receptor, delta 1
cow(781956) opioid receptor, delta 1
domestic cat(101088861) opioid receptor, delta 1
naked mole-rat(101721957) opioid receptor, delta 1
domestic guinea pig(100733231) opioid receptor, delta 1
sheep(101109600) opioid receptor, delta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
P1793 Pimozide human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000911 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145281 MISSION® esiRNA esiRNA human OPRD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000911 Rosetta Predictions human pricing
NM_012617 Rosetta Predictions rat pricing
NM_013622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080415 predicted 719
2 SASI_Hs01_00080416 predicted 608
3 SASI_Hs01_00080417 predicted 458
4 SASI_Hs02_00303480 predicted 691
5 SASI_Hs01_00080418 predicted 888
6 SASI_Hs01_00080419 predicted 824
7 SASI_Hs01_00080420 predicted 736
8 SASI_Hs01_00080421 predicted 899
9 SASI_Hs01_00080422 predicted 613
10 SASI_Hs02_00303481 predicted 705
11 SASI_Hs01_00080423 predicted 1397
12 SASI_Hs01_00080424 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056774 predicted 1031
2 SASI_Rn02_00259814 predicted 467
3 SASI_Rn01_00056775 predicted 560
4 SASI_Rn01_00056776 predicted 774
5 SASI_Rn01_00056778 predicted 312
6 SASI_Rn01_00056779 predicted 342
7 SASI_Rn01_00056781 predicted 598
8 SASI_Rn01_00056782 predicted 297
9 SASI_Rn01_00056783 predicted 1055
10 SASI_Rn02_00259815 predicted 684
11 SASI_Rn01_00056777 predicted 749
12 SASI_Rn01_00056780 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322398 predicted 793
2 SASI_Mm02_00322399 predicted 312
3 SASI_Mm01_00113406 predicted 1605
4 SASI_Mm02_00322400 predicted 742
5 SASI_Mm01_00113407 predicted 1452
6 SASI_Mm02_00322401 predicted 410
7 SASI_Mm01_00113408 predicted 920
8 SASI_Mm01_00113409 predicted 769
9 SASI_Mm01_00113410 predicted 682
10 SASI_Mm02_00322402 predicted 297
11 SASI_Mm01_00113405 predicted 1042
12 SASI_Mm01_00113411 predicted 798
13 SASI_Mm01_00113412 predicted 1371
14 SASI_Mm01_00113413 predicted 1569
15 SASI_Mm01_00113414 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000911
OPRD1 MISSION shRNA Bacterial Glycerol Stock
opioid receptor, delta 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000911.3-1195s21c1
Sequence:CCGGACGCTTTCCTCGACGAGAACTCTCGAGAGTTCTCGTCGAGGAAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000911.3-666s21c1
Sequence:CCGGATGAGTGTTGACCGCTACATCCTCGAGGATGTAGCGGTCAACACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000911.3-618s21c1
Sequence:CCGGTCCATCGACTACTACAATATGCTCGAGCATATTGTAGTAGTCGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-605s1c1
Sequence:CCGGGCTCTCCATCGACTACTACAACTCGAGTTGTAGTAGTCGATGGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000911.2-1548s1c1
Sequence:CCGGGCGAGGCAGAGGACAGATCAACTCGAGTTGATCTGTCCTCTGCCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-455s1c1
Sequence:CCGGCGTCCGGTACACTAAGATGAACTCGAGTTCATCTTAGTGTACCGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-1199s1c1
Sequence:CCGGCGAGAACTTCAAGCGCTGCTTCTCGAGAAGCAGCGCTTGAAGTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-1058s1c1
Sequence:CCGGGCCCATCCACATCTTCGTCATCTCGAGATGACGAAGATGTGGATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000911.3-1554s21c1
Sequence:CCGGGAGGCAGAGGACAGATCAATGCTCGAGCATTGATCTGTCCTCTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000911
OPRD1 MISSION shRNA shRNA Plasmid DNA
opioid receptor, delta 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000911.3-1195s21c1
Sequence:CCGGACGCTTTCCTCGACGAGAACTCTCGAGAGTTCTCGTCGAGGAAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000911.3-666s21c1
Sequence:CCGGATGAGTGTTGACCGCTACATCCTCGAGGATGTAGCGGTCAACACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000911.3-618s21c1
Sequence:CCGGTCCATCGACTACTACAATATGCTCGAGCATATTGTAGTAGTCGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-605s1c1
Sequence:CCGGGCTCTCCATCGACTACTACAACTCGAGTTGTAGTAGTCGATGGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000911.2-1548s1c1
Sequence:CCGGGCGAGGCAGAGGACAGATCAACTCGAGTTGATCTGTCCTCTGCCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-455s1c1
Sequence:CCGGCGTCCGGTACACTAAGATGAACTCGAGTTCATCTTAGTGTACCGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-1199s1c1
Sequence:CCGGCGAGAACTTCAAGCGCTGCTTCTCGAGAAGCAGCGCTTGAAGTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-1058s1c1
Sequence:CCGGGCCCATCCACATCTTCGTCATCTCGAGATGACGAAGATGTGGATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000911.3-1554s21c1
Sequence:CCGGGAGGCAGAGGACAGATCAATGCTCGAGCATTGATCTGTCCTCTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000911
OPRD1 MISSION shRNA Lentiviral Transduction Particles
opioid receptor, delta 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000911.3-1195s21c1
Sequence:CCGGACGCTTTCCTCGACGAGAACTCTCGAGAGTTCTCGTCGAGGAAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000911.3-666s21c1
Sequence:CCGGATGAGTGTTGACCGCTACATCCTCGAGGATGTAGCGGTCAACACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000911.3-618s21c1
Sequence:CCGGTCCATCGACTACTACAATATGCTCGAGCATATTGTAGTAGTCGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-605s1c1
Sequence:CCGGGCTCTCCATCGACTACTACAACTCGAGTTGTAGTAGTCGATGGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000911.2-1548s1c1
Sequence:CCGGGCGAGGCAGAGGACAGATCAACTCGAGTTGATCTGTCCTCTGCCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-455s1c1
Sequence:CCGGCGTCCGGTACACTAAGATGAACTCGAGTTCATCTTAGTGTACCGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-1199s1c1
Sequence:CCGGCGAGAACTTCAAGCGCTGCTTCTCGAGAAGCAGCGCTTGAAGTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000911.2-1058s1c1
Sequence:CCGGGCCCATCCACATCTTCGTCATCTCGAGATGACGAAGATGTGGATGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000911.3-1554s21c1
Sequence:CCGGGAGGCAGAGGACAGATCAATGCTCGAGCATTGATCTGTCCTCTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013622
OPRD1 MISSION shRNA Bacterial Glycerol Stock
opioid receptor, delta 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000027797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-303s1c1
Sequence:CCGGCGTGCTCGTCATGTTTGGCATCTCGAGATGCCAAACATGACGAGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-324s1c1
Sequence:CCGGCGTCCGGTACACCAAATTGAACTCGAGTTCAATTTGGTGTACCGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-735s1c1
Sequence:CCGGTGTGACCAAGATCTGCGTGTTCTCGAGAACACGCAGATCTTGGTCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-474s1c1
Sequence:CCGGGCTCTCCATTGACTACTACAACTCGAGTTGTAGTAGTCAATGGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013622
OPRD1 MISSION shRNA shRNA Plasmid DNA
opioid receptor, delta 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000027797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-303s1c1
Sequence:CCGGCGTGCTCGTCATGTTTGGCATCTCGAGATGCCAAACATGACGAGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-324s1c1
Sequence:CCGGCGTCCGGTACACCAAATTGAACTCGAGTTCAATTTGGTGTACCGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-735s1c1
Sequence:CCGGTGTGACCAAGATCTGCGTGTTCTCGAGAACACGCAGATCTTGGTCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-474s1c1
Sequence:CCGGGCTCTCCATTGACTACTACAACTCGAGTTGTAGTAGTCAATGGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013622
OPRD1 MISSION shRNA Lentiviral Transduction Particles
opioid receptor, delta 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000027797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-303s1c1
Sequence:CCGGCGTGCTCGTCATGTTTGGCATCTCGAGATGCCAAACATGACGAGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-324s1c1
Sequence:CCGGCGTCCGGTACACCAAATTGAACTCGAGTTCAATTTGGTGTACCGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-735s1c1
Sequence:CCGGTGTGACCAAGATCTGCGTGTTCTCGAGAACACGCAGATCTTGGTCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013622.2-474s1c1
Sequence:CCGGGCTCTCCATTGACTACTACAACTCGAGTTGTAGTAGTCAATGGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)