EMAIL THIS PAGE TO A FRIEND

OPRK1

opioid receptor, kappa 1

155 Gene Product Result for
Synonyms: KOR OPRK
UniProtKB ID: P41145, Q499G4
Gene ID:
Mouse(18387) opioid receptor, kappa 1
Rat(29335) opioid receptor, kappa 1
Zebrafish(360139) opioid receptor, kappa 1
chicken(428533) opioid receptor, kappa 1
cow(540519) opioid receptor, kappa 1
domestic cat(101094729) opioid receptor, kappa 1
dog(486951) opioid receptor, kappa 1
domestic guinea pig(100135587) opioid receptor, kappa 1
naked mole-rat(101712431) opioid receptor, kappa 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
B9156 Butorphanol (+)-tartrate salt ≥99% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000912 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000912 Rosetta Predictions human pricing
NM_017167 Rosetta Predictions rat pricing
NM_011011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303482 predicted 1378
2 SASI_Hs01_00219836 predicted 1422
3 SASI_Hs01_00219837 predicted 1426
4 SASI_Hs01_00219838 predicted 1306
5 SASI_Hs01_00219839 predicted 509
6 SASI_Hs01_00219840 predicted 1425
7 SASI_Hs01_00219841 predicted 1326
8 SASI_Hs01_00219842 predicted 1369
9 SASI_Hs01_00219843 predicted 1273
10 SASI_Hs01_00219844 predicted 1188
11 SASI_Hs01_00219845 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261482 predicted 803
2 SASI_Rn02_00261483 predicted 550
3 SASI_Rn02_00261484 predicted 1032
4 SASI_Rn02_00261485 predicted 292
5 SASI_Rn01_00099760 predicted 458
6 SASI_Rn01_00099761 predicted 595
7 SASI_Rn01_00099762 predicted 866
8 SASI_Rn01_00099765 predicted 447
9 SASI_Rn02_00261486 predicted 1130
10 SASI_Rn02_00261487 predicted 342
11 SASI_Rn01_00099757 predicted 428
12 SASI_Rn01_00099758 predicted 1388
13 SASI_Rn01_00099759 predicted 1441
14 SASI_Rn01_00099763 predicted 1492
15 SASI_Rn01_00099764 predicted 1335
16 SASI_Rn01_00099766 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146965 predicted 920
2 SASI_Mm01_00146966 predicted 671
3 SASI_Mm01_00146967 predicted 575
4 SASI_Mm01_00146968 predicted 980
5 SASI_Mm01_00146969 predicted 1106
6 SASI_Mm01_00146970 predicted 380
7 SASI_Mm01_00146971 predicted 408
8 SASI_Mm02_00319732 predicted 403
9 SASI_Mm01_00146973 predicted 453
10 SASI_Mm01_00146974 predicted 733
11 SASI_Mm01_00146972 predicted 701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000912
OPRK1 MISSION shRNA Bacterial Glycerol Stock
opioid receptor, kappa 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-1325s1c1
Sequence:CCGGCCTTAGGCTATACCAACAGTACTCGAGTACTGTTGGTATAGCCTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-627s1c1
Sequence:CCGGCATCCGATACACAAAGATGAACTCGAGTTCATCTTTGTGTATCGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000912.3-1422s21c1
Sequence:CCGGAGTTCAATGATCTAGGTTTAACTCGAGTTAAACCTAGATCATTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-990s1c1
Sequence:CCGGCGATGTCATTGAGTGCTCCTTCTCGAGAAGGAGCACTCAATGACATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-1442s1c1
Sequence:CCGGGCACTAGCAGAGTCCGAAATACTCGAGTATTTCGGACTCTGCTAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-894s1c1
Sequence:CCGGGAAGGCAAAGATCATCAATATCTCGAGATATTGATGATCTTTGCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000912.3-1816s21c1
Sequence:CCGGCCAACGGAATGGGAACTATTTCTCGAGAAATAGTTCCCATTCCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000912.3-1303s21c1
Sequence:CCGGCACTAGCAGAGTCCGAAATACCTCGAGGTATTTCGGACTCTGCTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000912
OPRK1 MISSION shRNA shRNA Plasmid DNA
opioid receptor, kappa 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-1325s1c1
Sequence:CCGGCCTTAGGCTATACCAACAGTACTCGAGTACTGTTGGTATAGCCTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-627s1c1
Sequence:CCGGCATCCGATACACAAAGATGAACTCGAGTTCATCTTTGTGTATCGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000912.3-1422s21c1
Sequence:CCGGAGTTCAATGATCTAGGTTTAACTCGAGTTAAACCTAGATCATTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-990s1c1
Sequence:CCGGCGATGTCATTGAGTGCTCCTTCTCGAGAAGGAGCACTCAATGACATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-1442s1c1
Sequence:CCGGGCACTAGCAGAGTCCGAAATACTCGAGTATTTCGGACTCTGCTAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-894s1c1
Sequence:CCGGGAAGGCAAAGATCATCAATATCTCGAGATATTGATGATCTTTGCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000912.3-1816s21c1
Sequence:CCGGCCAACGGAATGGGAACTATTTCTCGAGAAATAGTTCCCATTCCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000912.3-1303s21c1
Sequence:CCGGCACTAGCAGAGTCCGAAATACCTCGAGGTATTTCGGACTCTGCTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000912
OPRK1 MISSION shRNA Lentiviral Transduction Particles
opioid receptor, kappa 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-1325s1c1
Sequence:CCGGCCTTAGGCTATACCAACAGTACTCGAGTACTGTTGGTATAGCCTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-627s1c1
Sequence:CCGGCATCCGATACACAAAGATGAACTCGAGTTCATCTTTGTGTATCGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000912.3-1422s21c1
Sequence:CCGGAGTTCAATGATCTAGGTTTAACTCGAGTTAAACCTAGATCATTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-990s1c1
Sequence:CCGGCGATGTCATTGAGTGCTCCTTCTCGAGAAGGAGCACTCAATGACATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-1442s1c1
Sequence:CCGGGCACTAGCAGAGTCCGAAATACTCGAGTATTTCGGACTCTGCTAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000912.2-894s1c1
Sequence:CCGGGAAGGCAAAGATCATCAATATCTCGAGATATTGATGATCTTTGCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000912.3-1816s21c1
Sequence:CCGGCCAACGGAATGGGAACTATTTCTCGAGAAATAGTTCCCATTCCGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000912.3-1303s21c1
Sequence:CCGGCACTAGCAGAGTCCGAAATACCTCGAGGTATTTCGGACTCTGCTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011011
OPRK1 MISSION shRNA Bacterial Glycerol Stock
opioid receptor, kappa 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011011.1-412s21c1
Sequence:CCGGGCAATTCTCTGGTCATGTTTGCTCGAGCAAACATGACCAGAGAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-1220s1c1
Sequence:CCGGCTTCCCTATTAAGATGCGAATCTCGAGATTCGCATCTTAATAGGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-737s1c1
Sequence:CCGGCCTGGCATCATCTGTTGGTATCTCGAGATACCAACAGATGATGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-437s1c1
Sequence:CCGGCATCCGATACACGAAGATGAACTCGAGTTCATCTTCGTGTATCGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-374s1c1
Sequence:CCGGCGCTGTCTACTCTGTGGTATTCTCGAGAATACCACAGAGTAGACAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-1013s1c1
Sequence:CCGGGCTGGTAGTAGTTGCAGTCTTCTCGAGAAGACTGCAACTACTACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011011.1-684s21c1
Sequence:CCGGTTGGACTTCCGAACACCTTTGCTCGAGCAAAGGTGTTCGGAAGTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011011.1-571s21c1
Sequence:CCGGTGCTATGCAAGATTGTCATTTCTCGAGAAATGACAATCTTGCATAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011011
OPRK1 MISSION shRNA shRNA Plasmid DNA
opioid receptor, kappa 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011011.1-412s21c1
Sequence:CCGGGCAATTCTCTGGTCATGTTTGCTCGAGCAAACATGACCAGAGAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-1220s1c1
Sequence:CCGGCTTCCCTATTAAGATGCGAATCTCGAGATTCGCATCTTAATAGGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-737s1c1
Sequence:CCGGCCTGGCATCATCTGTTGGTATCTCGAGATACCAACAGATGATGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-437s1c1
Sequence:CCGGCATCCGATACACGAAGATGAACTCGAGTTCATCTTCGTGTATCGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-374s1c1
Sequence:CCGGCGCTGTCTACTCTGTGGTATTCTCGAGAATACCACAGAGTAGACAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-1013s1c1
Sequence:CCGGGCTGGTAGTAGTTGCAGTCTTCTCGAGAAGACTGCAACTACTACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011011.1-684s21c1
Sequence:CCGGTTGGACTTCCGAACACCTTTGCTCGAGCAAAGGTGTTCGGAAGTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011011.1-571s21c1
Sequence:CCGGTGCTATGCAAGATTGTCATTTCTCGAGAAATGACAATCTTGCATAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011011
OPRK1 MISSION shRNA Lentiviral Transduction Particles
opioid receptor, kappa 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011011.1-412s21c1
Sequence:CCGGGCAATTCTCTGGTCATGTTTGCTCGAGCAAACATGACCAGAGAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-1220s1c1
Sequence:CCGGCTTCCCTATTAAGATGCGAATCTCGAGATTCGCATCTTAATAGGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-737s1c1
Sequence:CCGGCCTGGCATCATCTGTTGGTATCTCGAGATACCAACAGATGATGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-437s1c1
Sequence:CCGGCATCCGATACACGAAGATGAACTCGAGTTCATCTTCGTGTATCGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-374s1c1
Sequence:CCGGCGCTGTCTACTCTGTGGTATTCTCGAGAATACCACAGAGTAGACAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011011.1-1013s1c1
Sequence:CCGGGCTGGTAGTAGTTGCAGTCTTCTCGAGAAGACTGCAACTACTACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011011.1-684s21c1
Sequence:CCGGTTGGACTTCCGAACACCTTTGCTCGAGCAAAGGTGTTCGGAAGTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011011.1-571s21c1
Sequence:CCGGTGCTATGCAAGATTGTCATTTCTCGAGAAATGACAATCTTGCATAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)