EMAIL THIS PAGE TO A FRIEND

OPRL1

opiate receptor-like 1

60 Gene Product Result for
Synonyms: KOR-3 NOCIR OOR ORL1
UniProtKB ID: P41146, Q8TD34, Q8WYH9, Q9H4K4
Gene ID:
Human(4987) Summary: The protein encoded by this gene is a G protein-coupled receptor whose expression can be induced by phytohemagglutinin. The encoded integral membrane protein is a receptor for the 17 aa neuropeptide nociceptin/orphanin FQ. This gene may be involved in the regulation of numerous brain activities, particularly instinctive and emotional behaviors. A promoter for this gene also functions as a promoter for another gene, regulator of G-protein signalling 19 (RGS19), located on the opposite strand. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(18389) opioid receptor-like 1
Rat(29256) opiate receptor-like 1
naked mole-rat(101706935) opiate receptor-like 1
domestic guinea pig(100135588) opioid receptor-like 1
sheep(101107542) opiate receptor-like 1
Zebrafish(402851) opiate receptor-like 1
cow(100335303) opiate receptor-like 1
cow(100296381) opiate receptor-like 1
domestic cat(101090851) opiate receptor-like 1
dog(485985) opiate receptor-like 1
chicken(419251) opiate receptor-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
N165 Naloxone benzoylhydrazone solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C4662 Carbetapentane citrate salt human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000913 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060761 MISSION® esiRNA esiRNA human OPRL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000913 Rosetta Predictions human pricing
NM_182647 Rosetta Predictions human pricing
NM_031569 Rosetta Predictions rat pricing
NM_011012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157681 predicted 744
2 SASI_Hs01_00157682 predicted 1535
3 SASI_Hs01_00157683 predicted 682
4 SASI_Hs01_00157684 predicted 1400
5 SASI_Hs01_00157685 predicted 1236
6 SASI_Hs02_00303483 predicted 585
7 SASI_Hs01_00157687 predicted 627
8 SASI_Hs01_00157688 predicted 1454
9 SASI_Hs01_00157689 predicted 666
10 SASI_Hs01_00157690 predicted 625
11 SASI_Hs01_00157686 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078108 predicted 887
2 SASI_Hs01_00078109 predicted 1686
3 SASI_Hs01_00078110 predicted 829
4 SASI_Hs01_00078111 predicted 1553
5 SASI_Hs01_00078112 predicted 1384
6 SASI_Hs02_00370808 predicted 781
7 SASI_Hs01_00078114 predicted 1605
8 SASI_Hs01_00078115 predicted 820
9 SASI_Hs01_00078116 predicted 769
10 SASI_Hs01_00078117 predicted 569
11 SASI_Hs01_00078113 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264811 predicted 355
2 SASI_Rn02_00264812 predicted 785
3 SASI_Rn02_00264813 predicted 752
4 SASI_Rn01_00088814 predicted 848
5 SASI_Rn02_00264814 predicted 874
6 SASI_Rn02_00264815 predicted 314
7 SASI_Rn02_00264816 predicted 273
8 SASI_Rn01_00088815 predicted 504
9 SASI_Rn02_00264817 predicted 412
10 SASI_Rn01_00088817 predicted 476
11 SASI_Rn01_00088813 predicted 350
12 SASI_Rn01_00088816 predicted 385
13 SASI_Rn01_00088818 predicted 1034
14 SASI_Rn01_00088819 predicted 1019
15 SASI_Rn01_00088820 predicted 1250
16 SASI_Rn01_00088821 predicted 659
17 SASI_Rn01_00088822 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105516 predicted 625
2 SASI_Mm01_00105517 predicted 487
3 SASI_Mm01_00105518 predicted 456
4 SASI_Mm01_00105519 predicted 640
5 SASI_Mm01_00105520 predicted 678
6 SASI_Mm01_00105521 predicted 692
7 SASI_Mm01_00105522 predicted 1069
8 SASI_Mm02_00319733 predicted 1135
9 SASI_Mm01_00105523 predicted 1127
10 SASI_Mm01_00105524 predicted 1366
11 SASI_Mm01_00105515 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011012
OPRL1 MISSION shRNA Bacterial Glycerol Stock
opiate receptor-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011012.4-278s21c1
Sequence:CCGGGGAACCTGTCTCTCCTAAATGCTCGAGCATTTAGGAGAGACAGGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011012.4-1782s21c1
Sequence:CCGGGCACAGAACTGGTGATCATACCTCGAGGTATGATCACCAGTTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-847s1c1
Sequence:CCGGCCCTGTATTTGCCATCTGCATCTCGAGATGCAGATGGCAAATACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-572s1c1
Sequence:CCGGGCACTGTGCAAGACGGTCATTCTCGAGAATGACCGTCTTGCACAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-1165s1c1
Sequence:CCGGCTATGCTTTCTTGGATGAGAACTCGAGTTCTCATCCAAGAAAGCATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011012.4-703s21c1
Sequence:CCGGAGTAAAGCCCAGGCCGTTAATCTCGAGATTAACGGCCTGGGCTTTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-421s1c1
Sequence:CCGGCCTCGTCATGTATGTCATCCTCTCGAGAGGATGACATACATGACGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-1007s1c1
Sequence:CCGGCTGGTAGTTGTGGCTGTGTTTCTCGAGAAACACAGCCACAACTACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011012
OPRL1 MISSION shRNA shRNA Plasmid DNA
opiate receptor-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011012.4-278s21c1
Sequence:CCGGGGAACCTGTCTCTCCTAAATGCTCGAGCATTTAGGAGAGACAGGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011012.4-1782s21c1
Sequence:CCGGGCACAGAACTGGTGATCATACCTCGAGGTATGATCACCAGTTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-847s1c1
Sequence:CCGGCCCTGTATTTGCCATCTGCATCTCGAGATGCAGATGGCAAATACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-572s1c1
Sequence:CCGGGCACTGTGCAAGACGGTCATTCTCGAGAATGACCGTCTTGCACAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-1165s1c1
Sequence:CCGGCTATGCTTTCTTGGATGAGAACTCGAGTTCTCATCCAAGAAAGCATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011012.4-703s21c1
Sequence:CCGGAGTAAAGCCCAGGCCGTTAATCTCGAGATTAACGGCCTGGGCTTTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-421s1c1
Sequence:CCGGCCTCGTCATGTATGTCATCCTCTCGAGAGGATGACATACATGACGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-1007s1c1
Sequence:CCGGCTGGTAGTTGTGGCTGTGTTTCTCGAGAAACACAGCCACAACTACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011012
OPRL1 MISSION shRNA Lentiviral Transduction Particles
opiate receptor-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011012.4-278s21c1
Sequence:CCGGGGAACCTGTCTCTCCTAAATGCTCGAGCATTTAGGAGAGACAGGTTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000444725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011012.4-1782s21c1
Sequence:CCGGGCACAGAACTGGTGATCATACCTCGAGGTATGATCACCAGTTCTGTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-847s1c1
Sequence:CCGGCCCTGTATTTGCCATCTGCATCTCGAGATGCAGATGGCAAATACAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-572s1c1
Sequence:CCGGGCACTGTGCAAGACGGTCATTCTCGAGAATGACCGTCTTGCACAGTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-1165s1c1
Sequence:CCGGCTATGCTTTCTTGGATGAGAACTCGAGTTCTCATCCAAGAAAGCATAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000445625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011012.4-703s21c1
Sequence:CCGGAGTAAAGCCCAGGCCGTTAATCTCGAGATTAACGGCCTGGGCTTTACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-421s1c1
Sequence:CCGGCCTCGTCATGTATGTCATCCTCTCGAGAGGATGACATACATGACGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011012.2-1007s1c1
Sequence:CCGGCTGGTAGTTGTGGCTGTGTTTCTCGAGAAACACAGCCACAACTACCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000913
OPRL1 MISSION shRNA Bacterial Glycerol Stock
opiate receptor-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000913.3-505s21c1
Sequence:CCGGCCACCAATATTTACATCTTTACTCGAGTAAAGATGTAAATATTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000913.3-679s21c1
Sequence:CCGGCCATGAGTGTGGATCGCTATGCTCGAGCATAGCGATCCACACTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000913.3-627s21c1
Sequence:CCGGGTCATTGCCATTGACTACTACCTCGAGGTAGTAGTCAATGGCAATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-458s1c1
Sequence:CCGGCTGCCTTGTCATGTACGTCATCTCGAGATGACGTACATGACAAGGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000913.3-2773s1c1
Sequence:CCGGGCAAATGCACTTCCTACAGATCTCGAGATCTGTAGGAAGTGCATTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-504s1c1
Sequence:CCGGGCCACCAATATTTACATCTTTCTCGAGAAAGATGTAAATATTGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000913.3-1543s21c1
Sequence:CCGGACATCATGGGACAGGTCAAAGCTCGAGCTTTGACCTGTCCCATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-612s1c1
Sequence:CCGGGCGCTGTGCAAGACAGTCATTCTCGAGAATGACTGTCTTGCACAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-629s1c1
Sequence:CCGGCATTGCCATTGACTACTACAACTCGAGTTGTAGTAGTCAATGGCAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000913
OPRL1 MISSION shRNA shRNA Plasmid DNA
opiate receptor-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000913.3-505s21c1
Sequence:CCGGCCACCAATATTTACATCTTTACTCGAGTAAAGATGTAAATATTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000913.3-679s21c1
Sequence:CCGGCCATGAGTGTGGATCGCTATGCTCGAGCATAGCGATCCACACTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000913.3-627s21c1
Sequence:CCGGGTCATTGCCATTGACTACTACCTCGAGGTAGTAGTCAATGGCAATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-458s1c1
Sequence:CCGGCTGCCTTGTCATGTACGTCATCTCGAGATGACGTACATGACAAGGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000913.3-2773s1c1
Sequence:CCGGGCAAATGCACTTCCTACAGATCTCGAGATCTGTAGGAAGTGCATTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-504s1c1
Sequence:CCGGGCCACCAATATTTACATCTTTCTCGAGAAAGATGTAAATATTGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000913.3-1543s21c1
Sequence:CCGGACATCATGGGACAGGTCAAAGCTCGAGCTTTGACCTGTCCCATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-612s1c1
Sequence:CCGGGCGCTGTGCAAGACAGTCATTCTCGAGAATGACTGTCTTGCACAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-629s1c1
Sequence:CCGGCATTGCCATTGACTACTACAACTCGAGTTGTAGTAGTCAATGGCAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000913
OPRL1 MISSION shRNA Lentiviral Transduction Particles
opiate receptor-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000913.3-505s21c1
Sequence:CCGGCCACCAATATTTACATCTTTACTCGAGTAAAGATGTAAATATTGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000913.3-679s21c1
Sequence:CCGGCCATGAGTGTGGATCGCTATGCTCGAGCATAGCGATCCACACTCATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000913.3-627s21c1
Sequence:CCGGGTCATTGCCATTGACTACTACCTCGAGGTAGTAGTCAATGGCAATGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-458s1c1
Sequence:CCGGCTGCCTTGTCATGTACGTCATCTCGAGATGACGTACATGACAAGGCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000913.3-2773s1c1
Sequence:CCGGGCAAATGCACTTCCTACAGATCTCGAGATCTGTAGGAAGTGCATTTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-504s1c1
Sequence:CCGGGCCACCAATATTTACATCTTTCTCGAGAAAGATGTAAATATTGGTGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000913.3-1543s21c1
Sequence:CCGGACATCATGGGACAGGTCAAAGCTCGAGCTTTGACCTGTCCCATGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-612s1c1
Sequence:CCGGGCGCTGTGCAAGACAGTCATTCTCGAGAATGACTGTCTTGCACAGCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000913.3-629s1c1
Sequence:CCGGCATTGCCATTGACTACTACAACTCGAGTTGTAGTAGTCAATGGCAATGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???