EMAIL THIS PAGE TO A FRIEND

OPRM1

opioid receptor, mu 1

329 Gene Product Result for
Synonyms: LMOR M-OR-1 MOP MOR MOR1 OPRM
Gene ID:
Human(4988) Summary: This gene encodes one of three opioid receptors. The mu opioid receptor is the principal target of endogenous opioid peptides and opioid analgesic agents such a s beta-endorphn and enkephalins. The NM_001008503.1:c.118A>G allele had been associated with opioid and alcohol addiction and variations in pain sensitivity but evidence is conflicting. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Mouse(18390) opioid receptor, mu 1
Rat(25601) opioid receptor, mu 1
Zebrafish(65088) opioid receptor, mu 1
cow(281958) opioid receptor, mu 1
Horse(100033967) opioid receptor, mu 1
domestic cat(101084452) opioid receptor, mu 1
dog(484041) opioid receptor, mu 1
chicken(421644) opioid receptor, mu 1
sheep(101104758) opioid receptor, mu 1
domestic guinea pig(100379267) opioid receptor, mu 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
L4762 Loperamide hydrochloride human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
B9156 Butorphanol (+)-tartrate salt ≥99% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000914 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000914 Rosetta Predictions human pricing
NM_001008503 Rosetta Predictions human pricing
NM_001008504 Rosetta Predictions human pricing
NM_001008505 Rosetta Predictions human pricing
NM_001038597 Rosetta Predictions rat pricing
NM_001038598 Rosetta Predictions rat pricing
NM_001038599 Rosetta Predictions rat pricing
NM_001038600 Rosetta Predictions rat pricing
NM_001038601 Rosetta Predictions rat pricing
NM_013071 Rosetta Predictions rat pricing
NM_001039652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188091 predicted 496
2 SASI_Hs01_00188092 predicted 511
3 SASI_Hs01_00188093 predicted 843
4 SASI_Hs01_00188094 predicted 895
5 SASI_Hs01_00188095 predicted 867
6 SASI_Hs01_00188096 predicted 631
7 SASI_Hs01_00188097 predicted 751
8 SASI_Hs02_00303484 predicted 618
9 SASI_Hs01_00188099 predicted 661
10 SASI_Hs01_00188100 predicted 622
11 SASI_Hs01_00188098 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049924 predicted 487
2 SASI_Hs01_00049925 predicted 515
3 SASI_Hs01_00049926 predicted 842
4 SASI_Hs01_00049927 predicted 895
5 SASI_Hs01_00049928 predicted 875
6 SASI_Hs01_00049929 predicted 626
7 SASI_Hs01_00049930 predicted 749
8 SASI_Hs02_00305482 predicted 612
9 SASI_Hs01_00049932 predicted 657
10 SASI_Hs01_00049933 predicted 621
11 SASI_Hs01_00049931 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155689 predicted 494
2 SASI_Hs01_00155690 predicted 516
3 SASI_Hs01_00155691 predicted 834
4 SASI_Hs01_00155692 predicted 891
5 SASI_Hs01_00155693 predicted 876
6 SASI_Hs01_00155694 predicted 626
7 SASI_Hs01_00155695 predicted 752
8 SASI_Hs02_00305483 predicted 612
9 SASI_Hs01_00155697 predicted 654
10 SASI_Hs01_00155698 predicted 627
11 SASI_Hs01_00155696 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032149 predicted 491
2 SASI_Hs01_00032150 predicted 515
3 SASI_Hs01_00032151 predicted 842
4 SASI_Hs01_00032152 predicted 893
5 SASI_Hs01_00032153 predicted 868
6 SASI_Hs01_00032154 predicted 627
7 SASI_Hs01_00032155 predicted 748
8 SASI_Hs02_00305484 predicted 609
9 SASI_Hs01_00032157 predicted 653
10 SASI_Hs01_00032158 predicted 621
11 SASI_Hs01_00032156 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066980 predicted 713
2 SASI_Rn01_00066981 predicted 764
3 SASI_Rn02_00204689 predicted 473
4 SASI_Rn01_00066982 predicted 620
5 SASI_Rn01_00066984 predicted 592
6 SASI_Rn01_00066985 predicted 400
7 SASI_Rn01_00066986 predicted 454
8 SASI_Rn01_00066988 predicted 553
9 SASI_Rn02_00204690 predicted 972
10 SASI_Rn02_00204691 predicted 1116
11 SASI_Rn01_00066983 predicted 688
12 SASI_Rn01_00066987 predicted 303
13 SASI_Rn01_00066989 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204692 predicted 719
2 SASI_Rn02_00204693 predicted 771
3 SASI_Rn02_00204694 predicted 476
4 SASI_Rn01_00120355 predicted 625
5 SASI_Rn01_00120356 predicted 591
6 SASI_Rn01_00120358 predicted 408
7 SASI_Rn01_00120359 predicted 460
8 SASI_Rn01_00120362 predicted 553
9 SASI_Rn02_00204695 predicted 978
10 SASI_Rn02_00204696 predicted 1116
11 SASI_Rn01_00120357 predicted 302
12 SASI_Rn01_00120360 predicted 301
13 SASI_Rn01_00120361 predicted 451
14 SASI_Rn01_00120363 predicted 393
15 SASI_Rn01_00120364 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056924 predicted 713
2 SASI_Rn02_00204697 predicted 768
3 SASI_Rn02_00204698 predicted 476
4 SASI_Rn02_00204699 predicted 624
5 SASI_Rn01_00056926 predicted 596
6 SASI_Rn01_00056927 predicted 407
7 SASI_Rn01_00056928 predicted 457
8 SASI_Rn02_00204700 predicted 550
9 SASI_Rn01_00056930 predicted 971
10 SASI_Rn01_00056931 predicted 1115
11 SASI_Rn01_00056925 predicted 1217
12 SASI_Rn01_00056929 predicted 1264
13 SASI_Rn01_00056932 predicted 1166
14 SASI_Rn01_00056933 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204701 predicted 721
2 SASI_Rn02_00204702 predicted 770
3 SASI_Rn02_00204703 predicted 482
4 SASI_Rn01_00090673 predicted 617
5 SASI_Rn01_00090674 predicted 593
6 SASI_Rn01_00090676 predicted 400
7 SASI_Rn01_00090677 predicted 455
8 SASI_Rn01_00090680 predicted 556
9 SASI_Rn02_00204704 predicted 976
10 SASI_Rn02_00204705 predicted 1119
11 SASI_Rn01_00090675 predicted 311
12 SASI_Rn01_00090678 predicted 298
13 SASI_Rn01_00090679 predicted 450
14 SASI_Rn01_00090681 predicted 405
15 SASI_Rn01_00090682 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204706 predicted 712
2 SASI_Rn02_00204707 predicted 771
3 SASI_Rn02_00204708 predicted 480
4 SASI_Rn01_00048505 predicted 618
5 SASI_Rn01_00048506 predicted 590
6 SASI_Rn01_00048508 predicted 405
7 SASI_Rn01_00048509 predicted 455
8 SASI_Rn01_00048512 predicted 558
9 SASI_Rn02_00204709 predicted 972
10 SASI_Rn02_00204710 predicted 1118
11 SASI_Rn01_00048507 predicted 317
12 SASI_Rn01_00048510 predicted 303
13 SASI_Rn01_00048511 predicted 457
14 SASI_Rn01_00048513 predicted 398
15 SASI_Rn01_00048514 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260821 predicted 720
2 SASI_Rn02_00260822 predicted 769
3 SASI_Rn02_00260823 predicted 480
4 SASI_Rn01_00099159 predicted 616
5 SASI_Rn01_00099160 predicted 591
6 SASI_Rn01_00099162 predicted 403
7 SASI_Rn01_00099163 predicted 455
8 SASI_Rn01_00099166 predicted 551
9 SASI_Rn02_00260824 predicted 972
10 SASI_Rn02_00260825 predicted 1118
11 SASI_Rn01_00099161 predicted 461
12 SASI_Rn01_00099164 predicted 444
13 SASI_Rn01_00099165 predicted 596
14 SASI_Rn01_00099167 predicted 547
15 SASI_Rn01_00099168 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187702 predicted 1658
2 SASI_Mm01_00187703 predicted 1026
3 SASI_Mm01_00187704 predicted 1659
4 SASI_Mm01_00187705 predicted 687
5 SASI_Mm01_00187706 predicted 1009
6 SASI_Mm01_00187707 predicted 1023
7 SASI_Mm01_00187708 predicted 1531
8 SASI_Mm01_00187709 predicted 993
9 SASI_Mm01_00187710 predicted 539
10 SASI_Mm01_00187711 predicted 1404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000914
OPRM1 MISSION shRNA Bacterial Glycerol Stock
opioid receptor, mu 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000914.1-1790s1c1
Sequence:CCGGCCGTAGTAACACATAAAGTAACTCGAGTTACTTTATGTGTTACTACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000914.3-1709s21c1
Sequence:CCGGTGTGAATTGAAGTCATCATAACTCGAGTTATGATGACTTCAATTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000914.3-968s21c1
Sequence:CCGGTTATGCCAGTGCTCATCATTACTCGAGTAATGATGAGCACTGGCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-965s1c1
Sequence:CCGGCGTGTGCTATGGACTGATGATCTCGAGATCATCAGTCCATAGCACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-1345s1c1
Sequence:CCGGCGGCCAATACAGTGGATAGAACTCGAGTTCTATCCACTGTATTGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-1180s1c1
Sequence:CCGGGCATTGCTCTAGGTTACACAACTCGAGTTGTGTAACCTAGAGCAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-587s1c1
Sequence:CCGGCCAGAGTGTGAATTACCTAATCTCGAGATTAGGTAATTCACACTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000914.3-671s21c1
Sequence:CCGGTGATCTCCATAGATTACTATACTCGAGTATAGTAATCTATGGAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000914
OPRM1 MISSION shRNA shRNA Plasmid DNA
opioid receptor, mu 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000914.1-1790s1c1
Sequence:CCGGCCGTAGTAACACATAAAGTAACTCGAGTTACTTTATGTGTTACTACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000914.3-1709s21c1
Sequence:CCGGTGTGAATTGAAGTCATCATAACTCGAGTTATGATGACTTCAATTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000914.3-968s21c1
Sequence:CCGGTTATGCCAGTGCTCATCATTACTCGAGTAATGATGAGCACTGGCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-965s1c1
Sequence:CCGGCGTGTGCTATGGACTGATGATCTCGAGATCATCAGTCCATAGCACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-1345s1c1
Sequence:CCGGCGGCCAATACAGTGGATAGAACTCGAGTTCTATCCACTGTATTGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-1180s1c1
Sequence:CCGGGCATTGCTCTAGGTTACACAACTCGAGTTGTGTAACCTAGAGCAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-587s1c1
Sequence:CCGGCCAGAGTGTGAATTACCTAATCTCGAGATTAGGTAATTCACACTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000914.3-671s21c1
Sequence:CCGGTGATCTCCATAGATTACTATACTCGAGTATAGTAATCTATGGAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000914
OPRM1 MISSION shRNA Lentiviral Transduction Particles
opioid receptor, mu 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000914.1-1790s1c1
Sequence:CCGGCCGTAGTAACACATAAAGTAACTCGAGTTACTTTATGTGTTACTACGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000914.3-1709s21c1
Sequence:CCGGTGTGAATTGAAGTCATCATAACTCGAGTTATGATGACTTCAATTCACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000914.3-968s21c1
Sequence:CCGGTTATGCCAGTGCTCATCATTACTCGAGTAATGATGAGCACTGGCATAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-965s1c1
Sequence:CCGGCGTGTGCTATGGACTGATGATCTCGAGATCATCAGTCCATAGCACACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-1345s1c1
Sequence:CCGGCGGCCAATACAGTGGATAGAACTCGAGTTCTATCCACTGTATTGGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-1180s1c1
Sequence:CCGGGCATTGCTCTAGGTTACACAACTCGAGTTGTGTAACCTAGAGCAATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000914.1-587s1c1
Sequence:CCGGCCAGAGTGTGAATTACCTAATCTCGAGATTAGGTAATTCACACTCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000914.3-671s21c1
Sequence:CCGGTGATCTCCATAGATTACTATACTCGAGTATAGTAATCTATGGAGATCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011013
OPRM1 MISSION shRNA Bacterial Glycerol Stock
opioid receptor, mu 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-1130s1c1
Sequence:CCGGCCTCCACAATCGAACAGCAAACTCGAGTTTGCTGTTCGATTGTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-1193s1c1
Sequence:CCGGCGGCTAATACAGTGGATCGAACTCGAGTTCGATCCACTGTATTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-1210s1c1
Sequence:CCGGCGAACTAACCACCAGAAGAAACTCGAGTTTCTTCTGGTGGTTAGTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-328s1c1
Sequence:CCGGCTGGTCATGTATGTGATTGTACTCGAGTACAATCACATACATGACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-492s1c1
Sequence:CCGGCGTGATCTCAATAGACTACTACTCGAGTAGTAGTCTATTGAGATCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011013
OPRM1 MISSION shRNA shRNA Plasmid DNA
opioid receptor, mu 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-1130s1c1
Sequence:CCGGCCTCCACAATCGAACAGCAAACTCGAGTTTGCTGTTCGATTGTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-1193s1c1
Sequence:CCGGCGGCTAATACAGTGGATCGAACTCGAGTTCGATCCACTGTATTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-1210s1c1
Sequence:CCGGCGAACTAACCACCAGAAGAAACTCGAGTTTCTTCTGGTGGTTAGTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-328s1c1
Sequence:CCGGCTGGTCATGTATGTGATTGTACTCGAGTACAATCACATACATGACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-492s1c1
Sequence:CCGGCGTGATCTCAATAGACTACTACTCGAGTAGTAGTCTATTGAGATCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011013
OPRM1 MISSION shRNA Lentiviral Transduction Particles
opioid receptor, mu 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-1130s1c1
Sequence:CCGGCCTCCACAATCGAACAGCAAACTCGAGTTTGCTGTTCGATTGTGGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-1193s1c1
Sequence:CCGGCGGCTAATACAGTGGATCGAACTCGAGTTCGATCCACTGTATTAGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-1210s1c1
Sequence:CCGGCGAACTAACCACCAGAAGAAACTCGAGTTTCTTCTGGTGGTTAGTTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-328s1c1
Sequence:CCGGCTGGTCATGTATGTGATTGTACTCGAGTACAATCACATACATGACCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011013.1-492s1c1
Sequence:CCGGCGTGATCTCAATAGACTACTACTCGAGTAGTAGTCTATTGAGATCACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)