EMAIL THIS PAGE TO A FRIEND

OR10A2

olfactory receptor, family 10, subfamily A, member 2

11 Gene Product Result for
Synonyms: OR10A2P OR11-82 OR11-86 OST363
Species: Human OR10A2(341276)
UniProtKB ID: Q9H208, B2RNL9, Q6IFG9
Gene ID:
Human(341276) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301087 ANTI-OR10A2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004460 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004460 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093506 predicted 370
2 SASI_Hs01_00093507 predicted 499
3 SASI_Hs01_00093508 predicted 52
4 SASI_Hs01_00093509 predicted 771
5 SASI_Hs01_00093510 predicted 775
6 SASI_Hs01_00093511 predicted 23
7 SASI_Hs01_00093512 predicted 32
8 SASI_Hs01_00093513 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004460
OR10A2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily A, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-60s21c1
Sequence:CCGGCATCTACCTGGTCACCCTGATCTCGAGATCAGGGTGACCAGGTAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-47s21c1
Sequence:CCGGTGACATTTCTAACCATCTACCCTCGAGGGTAGATGGTTAGAAATGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-365s21c1
Sequence:CCGGTCATGAACCAAAGGACTCGTGCTCGAGCACGAGTCCTTTGGTTCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-720s21c1
Sequence:CCGGATCATTAAGCCTCACCTACTTCTCGAGAAGTAGGTGAGGCTTAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-75s1c1
Sequence:CCGGCCTGATGGGAAACTGCCTCATCTCGAGATGAGGCAGTTTCCCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-134s1c1
Sequence:CCGGCCATGTACTTCTTCCTCAGAACTCGAGTTCTGAGGAAGAAGTACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-692s1c1
Sequence:CCGGACCTCCTTGTTGTCTCTCTTTCTCGAGAAAGAGAGACAACAAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-646s1c1
Sequence:CCGGCCATCAGCTAAAGGGAAGAATCTCGAGATTCTTCCCTTTAGCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-248s1c1
Sequence:CCGGGCTGTGCCACTCAGATGTATTCTCGAGAATACATCTGAGTGGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004460
OR10A2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily A, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-60s21c1
Sequence:CCGGCATCTACCTGGTCACCCTGATCTCGAGATCAGGGTGACCAGGTAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-47s21c1
Sequence:CCGGTGACATTTCTAACCATCTACCCTCGAGGGTAGATGGTTAGAAATGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-365s21c1
Sequence:CCGGTCATGAACCAAAGGACTCGTGCTCGAGCACGAGTCCTTTGGTTCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-720s21c1
Sequence:CCGGATCATTAAGCCTCACCTACTTCTCGAGAAGTAGGTGAGGCTTAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-75s1c1
Sequence:CCGGCCTGATGGGAAACTGCCTCATCTCGAGATGAGGCAGTTTCCCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-134s1c1
Sequence:CCGGCCATGTACTTCTTCCTCAGAACTCGAGTTCTGAGGAAGAAGTACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-692s1c1
Sequence:CCGGACCTCCTTGTTGTCTCTCTTTCTCGAGAAAGAGAGACAACAAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-646s1c1
Sequence:CCGGCCATCAGCTAAAGGGAAGAATCTCGAGATTCTTCCCTTTAGCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-248s1c1
Sequence:CCGGGCTGTGCCACTCAGATGTATTCTCGAGAATACATCTGAGTGGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004460
OR10A2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily A, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-60s21c1
Sequence:CCGGCATCTACCTGGTCACCCTGATCTCGAGATCAGGGTGACCAGGTAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-47s21c1
Sequence:CCGGTGACATTTCTAACCATCTACCCTCGAGGGTAGATGGTTAGAAATGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-365s21c1
Sequence:CCGGTCATGAACCAAAGGACTCGTGCTCGAGCACGAGTCCTTTGGTTCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004460.1-720s21c1
Sequence:CCGGATCATTAAGCCTCACCTACTTCTCGAGAAGTAGGTGAGGCTTAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-75s1c1
Sequence:CCGGCCTGATGGGAAACTGCCTCATCTCGAGATGAGGCAGTTTCCCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-134s1c1
Sequence:CCGGCCATGTACTTCTTCCTCAGAACTCGAGTTCTGAGGAAGAAGTACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-692s1c1
Sequence:CCGGACCTCCTTGTTGTCTCTCTTTCTCGAGAAAGAGAGACAACAAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-646s1c1
Sequence:CCGGCCATCAGCTAAAGGGAAGAATCTCGAGATTCTTCCCTTTAGCTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004460.1-248s1c1
Sequence:CCGGGCTGTGCCACTCAGATGTATTCTCGAGAATACATCTGAGTGGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)