EMAIL THIS PAGE TO A FRIEND

OR10A4

olfactory receptor, family 10, subfamily A, member 4

15 Gene Product Result for
Synonyms: JCG5 OR10A4P
UniProtKB ID: Q9H209, B2RNP5, B9EH36, Q96R20
Gene ID:
Human(283297) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
chicken(768801) olfactory receptor, family 10, subfamily A, member 4
cow(617571) olfactory receptor, family 10, subfamily A, member 4
dog(485351) olfactory receptor, family 10, subfamily A, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304036 ANTI-OR10A4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4501240 Anti-OR10A4 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207186 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207186 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228462 predicted 438
2 SASI_Hs01_00228463 predicted 541
3 SASI_Hs01_00228464 predicted 471
4 SASI_Hs01_00228465 predicted 434
5 SASI_Hs01_00228467 predicted 564
6 SASI_Hs01_00228468 predicted 473
7 SASI_Hs01_00228469 predicted 250
8 SASI_Hs01_00228470 predicted 647
9 SASI_Hs01_00228471 predicted 443
10 SASI_Hs02_00373813 predicted 660
11 SASI_Hs01_00228466 predicted 723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207186
OR10A4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily A, member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-763s21c1
Sequence:CCGGACTGCCATCCTCACGTATTTCCTCGAGGAAATACGTGAGGATGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-100s21c1
Sequence:CCGGACCATTTACTTGGTTACTTTACTCGAGTAAAGTAACCAAGTAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-134s21c1
Sequence:CCGGTCATCATCCTGGTCACTATAGCTCGAGCTATAGTGACCAGGATGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-402s21c1
Sequence:CCGGAGTCATCATGGGCCACATATCCTCGAGGATATGTGGCCCATGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-254s1c1
Sequence:CCGGCCCTGATCATTCAAGACACAACTCGAGTTGTGTCTTGAATGATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-666s1c1
Sequence:CCGGCCTCTCCACTATCTTCAGGATCTCGAGATCCTGAAGATAGTGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-615s1c1
Sequence:CCGGCCCATTCATTCTCTTTCCTTTCTCGAGAAAGGAAAGAGAATGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-207s1c1
Sequence:CCGGCCTGGAGATAGGTTTCAACTTCTCGAGAAGTTGAAACCTATCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-735s1c1
Sequence:CCGGCCTCTTGGTTGTCTCTCTCTTCTCGAGAAGAGAGAGACAACCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207186
OR10A4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily A, member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-763s21c1
Sequence:CCGGACTGCCATCCTCACGTATTTCCTCGAGGAAATACGTGAGGATGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-100s21c1
Sequence:CCGGACCATTTACTTGGTTACTTTACTCGAGTAAAGTAACCAAGTAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-134s21c1
Sequence:CCGGTCATCATCCTGGTCACTATAGCTCGAGCTATAGTGACCAGGATGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-402s21c1
Sequence:CCGGAGTCATCATGGGCCACATATCCTCGAGGATATGTGGCCCATGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-254s1c1
Sequence:CCGGCCCTGATCATTCAAGACACAACTCGAGTTGTGTCTTGAATGATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-666s1c1
Sequence:CCGGCCTCTCCACTATCTTCAGGATCTCGAGATCCTGAAGATAGTGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-615s1c1
Sequence:CCGGCCCATTCATTCTCTTTCCTTTCTCGAGAAAGGAAAGAGAATGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-207s1c1
Sequence:CCGGCCTGGAGATAGGTTTCAACTTCTCGAGAAGTTGAAACCTATCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-735s1c1
Sequence:CCGGCCTCTTGGTTGTCTCTCTCTTCTCGAGAAGAGAGAGACAACCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207186
OR10A4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily A, member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-763s21c1
Sequence:CCGGACTGCCATCCTCACGTATTTCCTCGAGGAAATACGTGAGGATGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-100s21c1
Sequence:CCGGACCATTTACTTGGTTACTTTACTCGAGTAAAGTAACCAAGTAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-134s21c1
Sequence:CCGGTCATCATCCTGGTCACTATAGCTCGAGCTATAGTGACCAGGATGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207186.1-402s21c1
Sequence:CCGGAGTCATCATGGGCCACATATCCTCGAGGATATGTGGCCCATGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-254s1c1
Sequence:CCGGCCCTGATCATTCAAGACACAACTCGAGTTGTGTCTTGAATGATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-666s1c1
Sequence:CCGGCCTCTCCACTATCTTCAGGATCTCGAGATCCTGAAGATAGTGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-615s1c1
Sequence:CCGGCCCATTCATTCTCTTTCCTTTCTCGAGAAAGGAAAGAGAATGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-207s1c1
Sequence:CCGGCCTGGAGATAGGTTTCAACTTCTCGAGAAGTTGAAACCTATCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207186.1-735s1c1
Sequence:CCGGCCTCTTGGTTGTCTCTCTCTTCTCGAGAAGAGAGAGACAACCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)