EMAIL THIS PAGE TO A FRIEND

OR10A6

olfactory receptor, family 10, subfamily A, member 6

16 Gene Product Result for
Synonyms: OR11-96
UniProtKB ID: Q8NH74, Q6IF59
Gene ID:
Human(390093) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(485375) olfactory receptor, family 10, subfamily A, member 6
cow(613938) olfactory receptor, family 10, subfamily A, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372373 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127591 MISSION® esiRNA esiRNA human OR10A6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004461 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063477 predicted 466
2 SASI_Hs01_00063478 predicted 500
3 SASI_Hs01_00063479 predicted 213
4 SASI_Hs01_00063480 predicted 384
5 SASI_Hs01_00063481 predicted 466
6 SASI_Hs01_00063482 predicted 380
7 SASI_Hs02_00304601 predicted 461
8 SASI_Hs01_00063483 predicted 379
9 SASI_Hs01_00063484 predicted 544
10 SASI_Hs01_00063485 predicted 543
11 SASI_Hs01_00063476 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372373
OR10A6 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily A, member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-210s1c1
Sequence:CCGGCCTGAGTTTCAGTGCAGTTATCTCGAGATAACTGCACTGAAACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-386s1c1
Sequence:CCGGCTCTCAACTACCAAATGATTACTCGAGTAATCATTTGGTAGTTGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-115s1c1
Sequence:CCGGCTGATAGGAAATGCCATTATTCTCGAGAATAATGGCATTTCCTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-385s1c1
Sequence:CCGGCCTCTCAACTACCAAATGATTCTCGAGAATCATTTGGTAGTTGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-295s1c1
Sequence:CCGGGCACAGATGTATTTCATCCTTCTCGAGAAGGATGAAATACATCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-732s1c1
Sequence:CCGGCCTCACATCTGTGACCCTATTCTCGAGAATAGGGTCACAGATGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-758s1c1
Sequence:CCGGGCACAGCCAGTATGACTTATTCTCGAGAATAAGTCATACTGGCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-544s1c1
Sequence:CCGGCCAGCAGTGTTAGAACTTGCACTCGAGTGCAAGTTCTAACACTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372373
OR10A6 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily A, member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-210s1c1
Sequence:CCGGCCTGAGTTTCAGTGCAGTTATCTCGAGATAACTGCACTGAAACTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-386s1c1
Sequence:CCGGCTCTCAACTACCAAATGATTACTCGAGTAATCATTTGGTAGTTGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-115s1c1
Sequence:CCGGCTGATAGGAAATGCCATTATTCTCGAGAATAATGGCATTTCCTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-385s1c1
Sequence:CCGGCCTCTCAACTACCAAATGATTCTCGAGAATCATTTGGTAGTTGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-295s1c1
Sequence:CCGGGCACAGATGTATTTCATCCTTCTCGAGAAGGATGAAATACATCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-732s1c1
Sequence:CCGGCCTCACATCTGTGACCCTATTCTCGAGAATAGGGTCACAGATGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-758s1c1
Sequence:CCGGGCACAGCCAGTATGACTTATTCTCGAGAATAAGTCATACTGGCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-544s1c1
Sequence:CCGGCCAGCAGTGTTAGAACTTGCACTCGAGTGCAAGTTCTAACACTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372373
OR10A6 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily A, member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-210s1c1
Sequence:CCGGCCTGAGTTTCAGTGCAGTTATCTCGAGATAACTGCACTGAAACTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-386s1c1
Sequence:CCGGCTCTCAACTACCAAATGATTACTCGAGTAATCATTTGGTAGTTGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-115s1c1
Sequence:CCGGCTGATAGGAAATGCCATTATTCTCGAGAATAATGGCATTTCCTATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-385s1c1
Sequence:CCGGCCTCTCAACTACCAAATGATTCTCGAGAATCATTTGGTAGTTGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-295s1c1
Sequence:CCGGGCACAGATGTATTTCATCCTTCTCGAGAAGGATGAAATACATCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-732s1c1
Sequence:CCGGCCTCACATCTGTGACCCTATTCTCGAGAATAGGGTCACAGATGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-758s1c1
Sequence:CCGGGCACAGCCAGTATGACTTATTCTCGAGAATAAGTCATACTGGCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372373.1-544s1c1
Sequence:CCGGCCAGCAGTGTTAGAACTTGCACTCGAGTGCAAGTTCTAACACTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)