EMAIL THIS PAGE TO A FRIEND

OR10AD1

olfactory receptor, family 10, subfamily AD, member 1

33 Gene Product Result for
Synonyms: OR10AD1P OR12-1
UniProtKB ID: Q8NGE0, B9EGT9, Q6IFA8
Gene ID:
Human(121275) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Rat(500926) olfactory receptor, family 10, subfamily AD, member 1
cow(515369) olfactory receptor, family 10, subfamily AD, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_062553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_062553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_062553 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004134 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009911 MISSION® esiRNA esiRNA targeting human OR10AD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004134 Rosetta Predictions human pricing
XM_001061072 Rosetta Predictions rat pricing
XM_576335 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096314 predicted 445
2 SASI_Hs01_00096315 predicted 519
3 SASI_Hs01_00096316 predicted 470
4 SASI_Hs01_00096317 predicted 635
5 SASI_Hs01_00096318 predicted 205
6 SASI_Hs01_00096319 predicted 378
7 SASI_Hs01_00096320 predicted 274
8 SASI_Hs01_00096321 predicted 578
9 SASI_Hs01_00096322 predicted 217
10 SASI_Hs01_00096323 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298700 predicted 782
2 SASI_Rn02_00298701 predicted 1109
3 SASI_Rn02_00298702 predicted 1109
4 SASI_Rn02_00298703 predicted 1170
5 SASI_Rn02_00298704 predicted 1238
6 SASI_Rn02_00298705 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405101 predicted 482
2 SASI_Rn02_00405102 predicted 775
3 SASI_Rn02_00405103 predicted 815
4 SASI_Rn02_00405104 predicted 510
5 SASI_Rn02_00405105 predicted 332
6 SASI_Rn02_00405106 predicted 685
7 SASI_Rn02_00405107 predicted 605
8 SASI_Rn02_00405108 predicted 644
9 SASI_Rn02_00405109 predicted 511
10 SASI_Rn02_00405110 predicted 509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_062553
OR10AD1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily AD, member 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-873s1c1
Sequence:CCGGGCCTGACAAAGACAAACCTTTCTCGAGAAAGGTTTGTCTTTGTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-456s1c1
Sequence:CCGGCCCACTTAACTATGTCCCGATCTCGAGATCGGGACATAGTTAAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-84s1c1
Sequence:CCGGCAGCATAGTGACGGAATTTATCTCGAGATAAATTCCGTCACTATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-337s1c1
Sequence:CCGGGACCACATTGTCTCCTTTGTACTCGAGTACAAAGGAGACAATGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_062553
OR10AD1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily AD, member 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-873s1c1
Sequence:CCGGGCCTGACAAAGACAAACCTTTCTCGAGAAAGGTTTGTCTTTGTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-456s1c1
Sequence:CCGGCCCACTTAACTATGTCCCGATCTCGAGATCGGGACATAGTTAAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-84s1c1
Sequence:CCGGCAGCATAGTGACGGAATTTATCTCGAGATAAATTCCGTCACTATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-337s1c1
Sequence:CCGGGACCACATTGTCTCCTTTGTACTCGAGTACAAAGGAGACAATGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_062553
OR10AD1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily AD, member 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-873s1c1
Sequence:CCGGGCCTGACAAAGACAAACCTTTCTCGAGAAAGGTTTGTCTTTGTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-456s1c1
Sequence:CCGGCCCACTTAACTATGTCCCGATCTCGAGATCGGGACATAGTTAAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-84s1c1
Sequence:CCGGCAGCATAGTGACGGAATTTATCTCGAGATAAATTCCGTCACTATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062553.1-337s1c1
Sequence:CCGGGACCACATTGTCTCCTTTGTACTCGAGTACAAAGGAGACAATGTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004134
OR10AD1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily AD, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-65s21c1
Sequence:CCGGCCACACGAGCATTGCTCTTTGCTCGAGCAAAGAGCAATGCTCGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-584s21c1
Sequence:CCGGTTAGTCTGTGGGCAATCTTTGCTCGAGCAAAGATTGCCCACAGACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-506s21c1
Sequence:CCGGTCCGCAGAGACAACCACATAGCTCGAGCTATGTGGTTGTCTCTGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-14s21c1
Sequence:CCGGGCAGCATAGTGACGGAATTTACTCGAGTAAATTCCGTCACTATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-392s21c1
Sequence:CCGGTTAACTATGTCCCGATCATAACTCGAGTTATGATCGGGACATAGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-122s21c1
Sequence:CCGGTGAATGGCCTCATCATCTTTACTCGAGTAAAGATGATGAGGCCATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004134
OR10AD1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily AD, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-65s21c1
Sequence:CCGGCCACACGAGCATTGCTCTTTGCTCGAGCAAAGAGCAATGCTCGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-584s21c1
Sequence:CCGGTTAGTCTGTGGGCAATCTTTGCTCGAGCAAAGATTGCCCACAGACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-506s21c1
Sequence:CCGGTCCGCAGAGACAACCACATAGCTCGAGCTATGTGGTTGTCTCTGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-14s21c1
Sequence:CCGGGCAGCATAGTGACGGAATTTACTCGAGTAAATTCCGTCACTATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-392s21c1
Sequence:CCGGTTAACTATGTCCCGATCATAACTCGAGTTATGATCGGGACATAGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-122s21c1
Sequence:CCGGTGAATGGCCTCATCATCTTTACTCGAGTAAAGATGATGAGGCCATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004134
OR10AD1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily AD, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-65s21c1
Sequence:CCGGCCACACGAGCATTGCTCTTTGCTCGAGCAAAGAGCAATGCTCGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-584s21c1
Sequence:CCGGTTAGTCTGTGGGCAATCTTTGCTCGAGCAAAGATTGCCCACAGACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-506s21c1
Sequence:CCGGTCCGCAGAGACAACCACATAGCTCGAGCTATGTGGTTGTCTCTGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-14s21c1
Sequence:CCGGGCAGCATAGTGACGGAATTTACTCGAGTAAATTCCGTCACTATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-392s21c1
Sequence:CCGGTTAACTATGTCCCGATCATAACTCGAGTTATGATCGGGACATAGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004134.1-122s21c1
Sequence:CCGGTGAATGGCCTCATCATCTTTACTCGAGTAAAGATGATGAGGCCATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)