EMAIL THIS PAGE TO A FRIEND

OR10C1

olfactory receptor, family 10, subfamily C, member 1

15 Gene Product Result for
Synonyms: OR10C1P OR10C2 OR6-31 hs6M1-17
UniProtKB ID: Q96KK4, Q5SUN7, Q96R18
Gene ID:
Human(442194) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(100300211) olfactory receptor, family 10, subfamily C, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013941 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013941 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097229 predicted 561
2 SASI_Hs01_00097230 predicted 279
3 SASI_Hs01_00097231 predicted 644
4 SASI_Hs01_00097232 predicted 651
5 SASI_Hs01_00097233 predicted 571
6 SASI_Hs01_00097234 predicted 260
7 SASI_Hs01_00097235 predicted 591
8 SASI_Hs01_00097236 predicted 646
9 SASI_Hs01_00097237 predicted 573
10 SASI_Hs02_00344879 predicted 654
11 SASI_Hs01_00097228 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013941
OR10C1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily C, member 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000204579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013941.2-200s1c1
Sequence:CCGGCCTTGGAGATTGGCTATACGTCTCGAGACGTATAGCCAATCTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013941.2-575s1c1
Sequence:CCGGCGCTTAATGAACTGCAGATTACTCGAGTAATCTGCAGTTCATTAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013941.2-510s1c1
Sequence:CCGGCAATACCATCCCGCAGTTCTTCTCGAGAAGAACTGCGGGATGGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013941
OR10C1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily C, member 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000204579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013941.2-200s1c1
Sequence:CCGGCCTTGGAGATTGGCTATACGTCTCGAGACGTATAGCCAATCTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013941.2-575s1c1
Sequence:CCGGCGCTTAATGAACTGCAGATTACTCGAGTAATCTGCAGTTCATTAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013941.2-510s1c1
Sequence:CCGGCAATACCATCCCGCAGTTCTTCTCGAGAAGAACTGCGGGATGGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013941
OR10C1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily C, member 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000204579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013941.2-200s1c1
Sequence:CCGGCCTTGGAGATTGGCTATACGTCTCGAGACGTATAGCCAATCTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013941.2-575s1c1
Sequence:CCGGCGCTTAATGAACTGCAGATTACTCGAGTAATCTGCAGTTCATTAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013941.2-510s1c1
Sequence:CCGGCAATACCATCCCGCAGTTCTTCTCGAGAAGAACTGCGGGATGGTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)