EMAIL THIS PAGE TO A FRIEND

OR10G4

olfactory receptor, family 10, subfamily G, member 4

5 Gene Product Result for
Synonyms: OR11-278
Species: Human OR10G4(390264)
UniProtKB ID: Q8NGN3, Q6IEW0
Gene ID:
Human(390264) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501706 Anti-OR10G4 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372436 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004462 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208393 predicted 597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372436
OR10G4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily G, member 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-594s1c1
Sequence:CCGGCTTTGTGGACATTGGGATAGTCTCGAGACTATCCCAATGTCCACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-577s1c1
Sequence:CCGGGCCAACGTGATGGTCATCTTTCTCGAGAAAGATGACCATCACGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-192s1c1
Sequence:CCGGGTCCTTCATTGACATGTGGTTCTCGAGAACCACATGTCAATGAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-736s1c1
Sequence:CCGGGTGGTCCTTTGCTTCTTTGTTCTCGAGAACAAAGAAGCAAAGGACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-763s1c1
Sequence:CCGGGTTGTCATTTATCTGAGGCCACTCGAGTGGCCTCAGATAAATGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-510s1c1
Sequence:CCGGCAACCAGATCCAGCACTACTTCTCGAGAAGTAGTGCTGGATCTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372436
OR10G4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily G, member 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-594s1c1
Sequence:CCGGCTTTGTGGACATTGGGATAGTCTCGAGACTATCCCAATGTCCACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-577s1c1
Sequence:CCGGGCCAACGTGATGGTCATCTTTCTCGAGAAAGATGACCATCACGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-192s1c1
Sequence:CCGGGTCCTTCATTGACATGTGGTTCTCGAGAACCACATGTCAATGAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-736s1c1
Sequence:CCGGGTGGTCCTTTGCTTCTTTGTTCTCGAGAACAAAGAAGCAAAGGACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-763s1c1
Sequence:CCGGGTTGTCATTTATCTGAGGCCACTCGAGTGGCCTCAGATAAATGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-510s1c1
Sequence:CCGGCAACCAGATCCAGCACTACTTCTCGAGAAGTAGTGCTGGATCTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372436
OR10G4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily G, member 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-594s1c1
Sequence:CCGGCTTTGTGGACATTGGGATAGTCTCGAGACTATCCCAATGTCCACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-577s1c1
Sequence:CCGGGCCAACGTGATGGTCATCTTTCTCGAGAAAGATGACCATCACGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-192s1c1
Sequence:CCGGGTCCTTCATTGACATGTGGTTCTCGAGAACCACATGTCAATGAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-736s1c1
Sequence:CCGGGTGGTCCTTTGCTTCTTTGTTCTCGAGAACAAAGAAGCAAAGGACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-763s1c1
Sequence:CCGGGTTGTCATTTATCTGAGGCCACTCGAGTGGCCTCAGATAAATGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372436.1-510s1c1
Sequence:CCGGCAACCAGATCCAGCACTACTTCTCGAGAAGTAGTGCTGGATCTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)