EMAIL THIS PAGE TO A FRIEND

OR10G8

olfactory receptor, family 10, subfamily G, member 8

10 Gene Product Result for
Synonyms: OR11-274 OR11-282
Species: Human OR10G8(219869)
UniProtKB ID: Q8NGN5, B2RNJ3, Q6IEV2
Gene ID:
Human(219869) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305834 ANTI-OR10G8(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166776 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004464 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015368 predicted 571
2 SASI_Hs01_00015369 predicted 220
3 SASI_Hs01_00015370 predicted 504
4 SASI_Hs01_00015374 predicted 220
5 SASI_Hs01_00015372 predicted 558
6 SASI_Hs01_00015373 predicted 284
7 SASI_Hs01_00015371 predicted 250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166776
OR10G8 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily G, member 8
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-330s1c1
Sequence:CCGGGTGTTTCCTCTACAGGGTCATCTCGAGATGACCCTGTAGAGGAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-575s1c2
Sequence:CCGGCAGCCATAGAGACTGTCATTTCTCGAGAAATGACAGTCTCTATGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-159s1c1
Sequence:CCGGCCACACCACCATGTACTACTTCTCGAGAAGTAGTACATGGTGGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-228s1c1
Sequence:CCGGGCCCAAATTGCTGATGACTTTCTCGAGAAAGTCATCAGCAATTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166776
OR10G8 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily G, member 8
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-330s1c1
Sequence:CCGGGTGTTTCCTCTACAGGGTCATCTCGAGATGACCCTGTAGAGGAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-575s1c2
Sequence:CCGGCAGCCATAGAGACTGTCATTTCTCGAGAAATGACAGTCTCTATGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-159s1c1
Sequence:CCGGCCACACCACCATGTACTACTTCTCGAGAAGTAGTACATGGTGGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-228s1c1
Sequence:CCGGGCCCAAATTGCTGATGACTTTCTCGAGAAAGTCATCAGCAATTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166776
OR10G8 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily G, member 8
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-330s1c1
Sequence:CCGGGTGTTTCCTCTACAGGGTCATCTCGAGATGACCCTGTAGAGGAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-575s1c2
Sequence:CCGGCAGCCATAGAGACTGTCATTTCTCGAGAAATGACAGTCTCTATGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-159s1c1
Sequence:CCGGCCACACCACCATGTACTACTTCTCGAGAAGTAGTACATGGTGGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166776.3-228s1c1
Sequence:CCGGGCCCAAATTGCTGATGACTTTCTCGAGAAAGTCATCAGCAATTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)