EMAIL THIS PAGE TO A FRIEND

OR10H3

olfactory receptor, family 10, subfamily H, member 3

14 Gene Product Result for
Species: Human OR10H3(26532)
UniProtKB ID: O60404, Q2HIZ3, Q6IFQ0
Gene ID:
Human(26532) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013938 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111291 MISSION® esiRNA esiRNA human OR10H3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013938 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077222 predicted 703
2 SASI_Hs01_00077223 predicted 247
3 SASI_Hs01_00077224 predicted 706
4 SASI_Hs01_00077226 predicted 386
5 SASI_Hs01_00077227 predicted 126
6 SASI_Hs01_00077225 predicted 18
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013938
OR10H3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily H, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-390s1c1
Sequence:CCGGACTGCATTACAACATGCTAATCTCGAGATTAGCATGTTGTAATGCAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-143s1c1
Sequence:CCGGCCACAGTTTGGATTGAACGCACTCGAGTGCGTTCAATCCAAACTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-130s1c1
Sequence:CCGGCTTCTTATCATGGCCACAGTTCTCGAGAACTGTGGCCATGATAAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-769s1c1
Sequence:CCGGGCCTCCCTTATCTACCTCAAACTCGAGTTTGAGGTAGATAAGGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-259s21c1
Sequence:CCGGCTCTTCACCCATCGTTCCATCCTCGAGGATGGAACGATGGGTGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-714s21c1
Sequence:CCGGGACTTTCTCCACTTGTGTATCCTCGAGGATACACAAGTGGAGAAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-116s21c1
Sequence:CCGGCATTGCTTGGCAACCTTCTTACTCGAGTAAGAAGGTTGCCAAGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-386s21c1
Sequence:CCGGACCCACTGCATTACAACATGCCTCGAGGCATGTTGTAATGCAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013938
OR10H3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily H, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-390s1c1
Sequence:CCGGACTGCATTACAACATGCTAATCTCGAGATTAGCATGTTGTAATGCAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-143s1c1
Sequence:CCGGCCACAGTTTGGATTGAACGCACTCGAGTGCGTTCAATCCAAACTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-130s1c1
Sequence:CCGGCTTCTTATCATGGCCACAGTTCTCGAGAACTGTGGCCATGATAAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-769s1c1
Sequence:CCGGGCCTCCCTTATCTACCTCAAACTCGAGTTTGAGGTAGATAAGGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-259s21c1
Sequence:CCGGCTCTTCACCCATCGTTCCATCCTCGAGGATGGAACGATGGGTGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-714s21c1
Sequence:CCGGGACTTTCTCCACTTGTGTATCCTCGAGGATACACAAGTGGAGAAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-116s21c1
Sequence:CCGGCATTGCTTGGCAACCTTCTTACTCGAGTAAGAAGGTTGCCAAGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-386s21c1
Sequence:CCGGACCCACTGCATTACAACATGCCTCGAGGCATGTTGTAATGCAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013938
OR10H3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily H, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-390s1c1
Sequence:CCGGACTGCATTACAACATGCTAATCTCGAGATTAGCATGTTGTAATGCAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-143s1c1
Sequence:CCGGCCACAGTTTGGATTGAACGCACTCGAGTGCGTTCAATCCAAACTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-130s1c1
Sequence:CCGGCTTCTTATCATGGCCACAGTTCTCGAGAACTGTGGCCATGATAAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013938.1-769s1c1
Sequence:CCGGGCCTCCCTTATCTACCTCAAACTCGAGTTTGAGGTAGATAAGGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-259s21c1
Sequence:CCGGCTCTTCACCCATCGTTCCATCCTCGAGGATGGAACGATGGGTGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-714s21c1
Sequence:CCGGGACTTTCTCCACTTGTGTATCCTCGAGGATACACAAGTGGAGAAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-116s21c1
Sequence:CCGGCATTGCTTGGCAACCTTCTTACTCGAGTAAGAAGGTTGCCAAGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013938.1-386s21c1
Sequence:CCGGACCCACTGCATTACAACATGCCTCGAGGCATGTTGTAATGCAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)