EMAIL THIS PAGE TO A FRIEND

OR10H4

olfactory receptor, family 10, subfamily H, member 4

11 Gene Product Result for
Synonyms: OR19-28
Species: Human OR10H4(126541)
UniProtKB ID: Q8NGA5, Q6IFJ2, Q96R57
Gene ID:
Human(126541) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304227 ANTI-OR10H4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4500343 Anti-OR10H4 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_065153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_065153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_065153 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004465 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160741 predicted 469
2 SASI_Hs01_00160742 predicted 289
3 SASI_Hs01_00160743 predicted 10
4 SASI_Hs01_00160745 predicted 249
5 SASI_Hs01_00160746 predicted 141
6 SASI_Hs01_00160747 predicted 8
7 SASI_Hs01_00160744 predicted 254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_065153
OR10H4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily H, member 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000189217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-264s1c1
Sequence:CCGGCACCCATCATTCCATCACCTTCTCGAGAAGGTGATGGAATGATGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-645s1c1
Sequence:CCGGCATCATCCTCTCCTATGTCTTCTCGAGAAGACATAGGAGAGGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-553s1c1
Sequence:CCGGCTCTTGAAGTTGGCCTGTGAACTCGAGTTCACAGGCCAACTTCAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-576s1c1
Sequence:CCGGCAAGACATCATCTGTCATCATCTCGAGATGATGACAGATGATGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_065153
OR10H4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily H, member 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000189217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-264s1c1
Sequence:CCGGCACCCATCATTCCATCACCTTCTCGAGAAGGTGATGGAATGATGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-645s1c1
Sequence:CCGGCATCATCCTCTCCTATGTCTTCTCGAGAAGACATAGGAGAGGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-553s1c1
Sequence:CCGGCTCTTGAAGTTGGCCTGTGAACTCGAGTTCACAGGCCAACTTCAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-576s1c1
Sequence:CCGGCAAGACATCATCTGTCATCATCTCGAGATGATGACAGATGATGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_065153
OR10H4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily H, member 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000189217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-264s1c1
Sequence:CCGGCACCCATCATTCCATCACCTTCTCGAGAAGGTGATGGAATGATGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-645s1c1
Sequence:CCGGCATCATCCTCTCCTATGTCTTCTCGAGAAGACATAGGAGAGGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-553s1c1
Sequence:CCGGCTCTTGAAGTTGGCCTGTGAACTCGAGTTCACAGGCCAACTTCAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_065153.1-576s1c1
Sequence:CCGGCAAGACATCATCTGTCATCATCTCGAGATGATGACAGATGATGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)