EMAIL THIS PAGE TO A FRIEND

OR10J1

olfactory receptor, family 10, subfamily J, member 1

18 Gene Product Result for
Synonyms: HGMP07J HSHGMP07J
Species: Human OR10J1(26476)
UniProtKB ID: P30954, Q2M1M8, Q5VSV1, Q6IET5, Q96R56
Gene ID:
Human(26476) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501141 Anti-OR10J1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012351 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105051 MISSION® esiRNA esiRNA human OR10J1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012351 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225695 predicted 219
2 SASI_Hs01_00225696 predicted 225
3 SASI_Hs01_00225697 predicted 525
4 SASI_Hs01_00225698 predicted 637
5 SASI_Hs01_00225699 predicted 434
6 SASI_Hs01_00225700 predicted 229
7 SASI_Hs01_00225701 predicted 269
8 SASI_Hs01_00225702 predicted 500
9 SASI_Hs01_00225703 predicted 508
10 SASI_Hs02_00344160 predicted 502
11 SASI_Hs01_00225704 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012351
OR10J1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily J, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012351.2-282s21c1
Sequence:CCGGCTGTATATACATTGGTCATTCCTCGAGGAATGACCAATGTATATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012351.2-456s21c1
Sequence:CCGGCCCTGAGATACATGGTTATTACTCGAGTAATAACCATGTATCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-130s1c1
Sequence:CCGGGCACTATACATCTTAACCTTACTCGAGTAAGGTTAAGATGTATAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-528s1c1
Sequence:CCGGGTTACCCTTCTGTGCTAGAAACTCGAGTTTCTAGCACAGAAGGGTAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012351.2-178s21c1
Sequence:CCGGCTTAACCTTAGCAGGCAATATCTCGAGATATTGCCTGCTAAGGTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-169s1c1
Sequence:CCGGGTGACCATCATCCGAATTGATCTCGAGATCAATTCGGATGATGGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-642s1c1
Sequence:CCGGGCTGGTGCTTGTTGTACCTATCTCGAGATAGGTACAACAAGCACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-609s1c1
Sequence:CCGGTGTCAATGAAATCCTGACTTTCTCGAGAAAGTCAGGATTTCATTGACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012351
OR10J1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily J, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012351.2-282s21c1
Sequence:CCGGCTGTATATACATTGGTCATTCCTCGAGGAATGACCAATGTATATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012351.2-456s21c1
Sequence:CCGGCCCTGAGATACATGGTTATTACTCGAGTAATAACCATGTATCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-130s1c1
Sequence:CCGGGCACTATACATCTTAACCTTACTCGAGTAAGGTTAAGATGTATAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-528s1c1
Sequence:CCGGGTTACCCTTCTGTGCTAGAAACTCGAGTTTCTAGCACAGAAGGGTAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012351.2-178s21c1
Sequence:CCGGCTTAACCTTAGCAGGCAATATCTCGAGATATTGCCTGCTAAGGTTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-169s1c1
Sequence:CCGGGTGACCATCATCCGAATTGATCTCGAGATCAATTCGGATGATGGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-642s1c1
Sequence:CCGGGCTGGTGCTTGTTGTACCTATCTCGAGATAGGTACAACAAGCACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-609s1c1
Sequence:CCGGTGTCAATGAAATCCTGACTTTCTCGAGAAAGTCAGGATTTCATTGACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012351
OR10J1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily J, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012351.2-282s21c1
Sequence:CCGGCTGTATATACATTGGTCATTCCTCGAGGAATGACCAATGTATATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012351.2-456s21c1
Sequence:CCGGCCCTGAGATACATGGTTATTACTCGAGTAATAACCATGTATCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-130s1c1
Sequence:CCGGGCACTATACATCTTAACCTTACTCGAGTAAGGTTAAGATGTATAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-528s1c1
Sequence:CCGGGTTACCCTTCTGTGCTAGAAACTCGAGTTTCTAGCACAGAAGGGTAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012351.2-178s21c1
Sequence:CCGGCTTAACCTTAGCAGGCAATATCTCGAGATATTGCCTGCTAAGGTTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-169s1c1
Sequence:CCGGGTGACCATCATCCGAATTGATCTCGAGATCAATTCGGATGATGGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-642s1c1
Sequence:CCGGGCTGGTGCTTGTTGTACCTATCTCGAGATAGGTACAACAAGCACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012351.1-609s1c1
Sequence:CCGGTGTCAATGAAATCCTGACTTTCTCGAGAAAGTCAGGATTTCATTGACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)