EMAIL THIS PAGE TO A FRIEND

OR10J3

olfactory receptor, family 10, subfamily J, member 3

18 Gene Product Result for
Synonyms: OR1-25 OR10J3P
UniProtKB ID: Q5JRS4
Gene ID:
Human(441911) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(509261) olfactory receptor, family 10, subfamily J, member 3
cow(504688) olfactory receptor, family 10, subfamily J, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004467 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004467 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035806 predicted 734
2 SASI_Hs01_00035807 predicted 627
3 SASI_Hs01_00035808 predicted 298
4 SASI_Hs01_00035809 predicted 606
5 SASI_Hs01_00035810 predicted 412
6 SASI_Hs02_00304602 predicted 490
7 SASI_Hs01_00035811 predicted 276
8 SASI_Hs01_00035813 predicted 463
9 SASI_Hs01_00035814 predicted 607
10 SASI_Hs01_00035815 predicted 460
11 SASI_Hs01_00035812 predicted 519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004467
OR10J3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily J, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-499s1c1
Sequence:CCGGCTGCCATTCTGTGATGCCTTTCTCGAGAAAGGCATCACAGAATGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-816s1c1
Sequence:CCGGCAGACTCATCTCAGTGACCTACTCGAGTAGGTCACTGAGATGAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-671s1c1
Sequence:CCGGCCACCATTCTTAAGATTGCCTCTCGAGAGGCAATCTTAAGAATGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-66s1c1
Sequence:CCGGGCAGCACAAACTTGTCTTCTTCTCGAGAAGAAGACAAGTTTGTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-84s1c1
Sequence:CCGGCTTTGTTGTCTTCCTAACTTTCTCGAGAAAGTTAGGAAGACAACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004467
OR10J3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily J, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-499s1c1
Sequence:CCGGCTGCCATTCTGTGATGCCTTTCTCGAGAAAGGCATCACAGAATGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-816s1c1
Sequence:CCGGCAGACTCATCTCAGTGACCTACTCGAGTAGGTCACTGAGATGAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-671s1c1
Sequence:CCGGCCACCATTCTTAAGATTGCCTCTCGAGAGGCAATCTTAAGAATGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-66s1c1
Sequence:CCGGGCAGCACAAACTTGTCTTCTTCTCGAGAAGAAGACAAGTTTGTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-84s1c1
Sequence:CCGGCTTTGTTGTCTTCCTAACTTTCTCGAGAAAGTTAGGAAGACAACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004467
OR10J3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily J, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-499s1c1
Sequence:CCGGCTGCCATTCTGTGATGCCTTTCTCGAGAAAGGCATCACAGAATGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-816s1c1
Sequence:CCGGCAGACTCATCTCAGTGACCTACTCGAGTAGGTCACTGAGATGAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-671s1c1
Sequence:CCGGCCACCATTCTTAAGATTGCCTCTCGAGAGGCAATCTTAAGAATGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-66s1c1
Sequence:CCGGGCAGCACAAACTTGTCTTCTTCTCGAGAAGAAGACAAGTTTGTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004467.1-84s1c1
Sequence:CCGGCTTTGTTGTCTTCCTAACTTTCTCGAGAAAGTTAGGAAGACAACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)