EMAIL THIS PAGE TO A FRIEND

OR10K1

olfactory receptor, family 10, subfamily K, member 1

18 Gene Product Result for
Synonyms: OR1-6
UniProtKB ID: Q8NGX5, Q6IFS2
Gene ID:
Human(391109) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(515038) olfactory receptor, family 10, subfamily K, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372797 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148041 MISSION® esiRNA esiRNA human OR10K1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004473 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162966 predicted 466
2 SASI_Hs01_00162967 predicted 591
3 SASI_Hs01_00162968 predicted 615
4 SASI_Hs02_00304612 predicted 572
5 SASI_Hs01_00162969 predicted 600
6 SASI_Hs01_00162970 predicted 682
7 SASI_Hs02_00304613 predicted 503
8 SASI_Hs01_00162971 predicted 582
9 SASI_Hs01_00162972 predicted 570
10 SASI_Hs01_00162973 predicted 653
11 SASI_Hs01_00162974 predicted 631
12 SASI_Hs01_00162975 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372797
OR10K1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily K, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-659s1c1
Sequence:CCGGGCATCATCTCTGCCATTCTAACTCGAGTTAGAATGGCAGAGATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-693s1c1
Sequence:CCGGCGTTGGAAGATACAAGACCTTCTCGAGAAGGTCTTGTATCTTCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-260s1c1
Sequence:CCGGCCCAGAAGAAGACCATTTCTTCTCGAGAAGAAATGGTCTTCTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-261s1c1
Sequence:CCGGCCAGAAGAAGACCATTTCTTTCTCGAGAAAGAAATGGTCTTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-119s1c1
Sequence:CCGGGCACCAATGCAATCATCATTTCTCGAGAAATGATGATTGCATTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-161s1c1
Sequence:CCGGCCCTTCATACTCCCATGTACTCTCGAGAGTACATGGGAGTATGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372797
OR10K1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily K, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-659s1c1
Sequence:CCGGGCATCATCTCTGCCATTCTAACTCGAGTTAGAATGGCAGAGATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-693s1c1
Sequence:CCGGCGTTGGAAGATACAAGACCTTCTCGAGAAGGTCTTGTATCTTCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-260s1c1
Sequence:CCGGCCCAGAAGAAGACCATTTCTTCTCGAGAAGAAATGGTCTTCTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-261s1c1
Sequence:CCGGCCAGAAGAAGACCATTTCTTTCTCGAGAAAGAAATGGTCTTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-119s1c1
Sequence:CCGGGCACCAATGCAATCATCATTTCTCGAGAAATGATGATTGCATTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-161s1c1
Sequence:CCGGCCCTTCATACTCCCATGTACTCTCGAGAGTACATGGGAGTATGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372797
OR10K1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily K, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-659s1c1
Sequence:CCGGGCATCATCTCTGCCATTCTAACTCGAGTTAGAATGGCAGAGATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-693s1c1
Sequence:CCGGCGTTGGAAGATACAAGACCTTCTCGAGAAGGTCTTGTATCTTCCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-260s1c1
Sequence:CCGGCCCAGAAGAAGACCATTTCTTCTCGAGAAGAAATGGTCTTCTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-261s1c1
Sequence:CCGGCCAGAAGAAGACCATTTCTTTCTCGAGAAAGAAATGGTCTTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-119s1c1
Sequence:CCGGGCACCAATGCAATCATCATTTCTCGAGAAATGATGATTGCATTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372797.1-161s1c1
Sequence:CCGGCCCTTCATACTCCCATGTACTCTCGAGAGTACATGGGAGTATGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)