EMAIL THIS PAGE TO A FRIEND

OR10K2

olfactory receptor, family 10, subfamily K, member 2

14 Gene Product Result for
Synonyms: OR1-4
UniProtKB ID: Q6IF99
Gene ID:
Human(391107) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(532341) olfactory receptor, family 10, subfamily K, member 2
dog(488611) olfactory receptor, family 10, subfamily K, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004476 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118846 predicted 349
2 SASI_Hs01_00118847 predicted 655
3 SASI_Hs02_00304616 predicted 481
4 SASI_Hs01_00118848 predicted 570
5 SASI_Hs02_00304617 predicted 360
6 SASI_Hs01_00118850 predicted 556
7 SASI_Hs01_00118851 predicted 563
8 SASI_Hs01_00118852 predicted 355
9 SASI_Hs01_00118853 predicted 663
10 SASI_Hs01_00118854 predicted 204
11 SASI_Hs01_00118849 predicted 692
12 SASI_Hs01_00118855 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004476
OR10K2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily K, member 2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000061218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004476.1-719s1c1
Sequence:CCGGCCTGTGTATCTCACCTCATTACTCGAGTAATGAGGTGAGATACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004476.1-668s1c1
Sequence:CCGGCTGCCATACTTCAGTTTCCTTCTCGAGAAGGAAACTGAAGTATGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004476.1-210s1c1
Sequence:CCGGGATTTGCTACACCTTCATCATCTCGAGATGATGAAGGTGTAGCAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004476
OR10K2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily K, member 2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000061218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004476.1-719s1c1
Sequence:CCGGCCTGTGTATCTCACCTCATTACTCGAGTAATGAGGTGAGATACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004476.1-668s1c1
Sequence:CCGGCTGCCATACTTCAGTTTCCTTCTCGAGAAGGAAACTGAAGTATGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004476.1-210s1c1
Sequence:CCGGGATTTGCTACACCTTCATCATCTCGAGATGATGAAGGTGTAGCAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004476
OR10K2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily K, member 2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000061218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004476.1-719s1c1
Sequence:CCGGCCTGTGTATCTCACCTCATTACTCGAGTAATGAGGTGAGATACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004476.1-668s1c1
Sequence:CCGGCTGCCATACTTCAGTTTCCTTCTCGAGAAGGAAACTGAAGTATGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004476.1-210s1c1
Sequence:CCGGGATTTGCTACACCTTCATCATCTCGAGATGATGAAGGTGTAGCAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)