EMAIL THIS PAGE TO A FRIEND

OR10P1

olfactory receptor, family 10, subfamily P, member 1

13 Gene Product Result for
Synonyms: OR10P1P OR10P2P OR10P3P OR12-7 OST701
UniProtKB ID: Q8NGE3, B9EGY4
Gene ID:
Human(121130) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(520305) olfactory receptor, family 10, subfamily P, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_062468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_062468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_062468 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206899 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237136 predicted 602
2 SASI_Hs01_00237137 predicted 509
3 SASI_Hs01_00237138 predicted 608
4 SASI_Hs01_00237139 predicted 608
5 SASI_Hs01_00237140 predicted 296
6 SASI_Hs01_00237141 predicted 511
7 SASI_Hs01_00237142 predicted 595
8 SASI_Hs01_00237143 predicted 269
9 SASI_Hs01_00237145 predicted 527
10 SASI_Hs02_00373591 predicted 649
11 SASI_Hs01_00237144 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_062468
OR10P1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily P, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-486s1c1
Sequence:CCGGCCTCATCTTCTCTCTACCTTTCTCGAGAAAGGTAGAGAGAAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-528s1c1
Sequence:CCGGGCACTTTCTCTGTGACATCCTCTCGAGAGGATGTCACAGAGAAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-753s1c1
Sequence:CCGGCTTCTTTGGAACAGCCAGCATCTCGAGATGCTGGCTGTTCCAAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-360s1c1
Sequence:CCGGCTATGACCGATATGTTGCCATCTCGAGATGGCAACATATCGGTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-603s1c1
Sequence:CCGGGACAGCCACCATAGTCTTCATCTCGAGATGAAGACTATGGTGGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_062468
OR10P1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily P, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-486s1c1
Sequence:CCGGCCTCATCTTCTCTCTACCTTTCTCGAGAAAGGTAGAGAGAAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-528s1c1
Sequence:CCGGGCACTTTCTCTGTGACATCCTCTCGAGAGGATGTCACAGAGAAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-753s1c1
Sequence:CCGGCTTCTTTGGAACAGCCAGCATCTCGAGATGCTGGCTGTTCCAAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-360s1c1
Sequence:CCGGCTATGACCGATATGTTGCCATCTCGAGATGGCAACATATCGGTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-603s1c1
Sequence:CCGGGACAGCCACCATAGTCTTCATCTCGAGATGAAGACTATGGTGGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_062468
OR10P1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily P, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-486s1c1
Sequence:CCGGCCTCATCTTCTCTCTACCTTTCTCGAGAAAGGTAGAGAGAAGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-528s1c1
Sequence:CCGGGCACTTTCTCTGTGACATCCTCTCGAGAGGATGTCACAGAGAAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-753s1c1
Sequence:CCGGCTTCTTTGGAACAGCCAGCATCTCGAGATGCTGGCTGTTCCAAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-360s1c1
Sequence:CCGGCTATGACCGATATGTTGCCATCTCGAGATGGCAACATATCGGTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062468.4-603s1c1
Sequence:CCGGGACAGCCACCATAGTCTTCATCTCGAGATGAAGACTATGGTGGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)