EMAIL THIS PAGE TO A FRIEND

OR10S1

olfactory receptor, family 10, subfamily S, member 1

17 Gene Product Result for
Synonyms: OR11-279
UniProtKB ID: Q8NGN2, B9EH43, Q6IEV3, Q96R78
Gene ID:
Human(219873) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(512551) olfactory receptor, family 10, subfamily S, member 1
dog(100688600) olfactory receptor, family 10, subfamily S, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004474 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150051 MISSION® esiRNA esiRNA human OR10S1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004474 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304614 predicted 259
2 SASI_Hs01_00025104 predicted 435
3 SASI_Hs01_00025105 predicted 289
4 SASI_Hs01_00025106 predicted 240
5 SASI_Hs01_00025107 predicted 556
6 SASI_Hs01_00025108 predicted 338
7 SASI_Hs01_00025109 predicted 669
8 SASI_Hs01_00025110 predicted 552
9 SASI_Hs01_00025111 predicted 610
10 SASI_Hs01_00025112 predicted 628
11 SASI_Hs01_00025113 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004474
OR10S1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily S, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-565s1c1
Sequence:CCGGGCCTACTTCTTCTGCGACATACTCGAGTATGTCGCAGAAGAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-99s1c1
Sequence:CCGGCGCTAAACATTCTAGCCTCTTCTCGAGAAGAGGCTAGAATGTTTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-678s1c1
Sequence:CCGGCCTCATCGTTATTTCCTACATCTCGAGATGTAGGAAATAACGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-462s1c1
Sequence:CCGGGTGTGCAGAAATGGCTGGAATCTCGAGATTCCAGCCATTTCTGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-329s1c1
Sequence:CCGGGCTGTGCCGTACAGCTTTATTCTCGAGAATAAAGCTGTACGGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004474
OR10S1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily S, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-565s1c1
Sequence:CCGGGCCTACTTCTTCTGCGACATACTCGAGTATGTCGCAGAAGAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-99s1c1
Sequence:CCGGCGCTAAACATTCTAGCCTCTTCTCGAGAAGAGGCTAGAATGTTTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-678s1c1
Sequence:CCGGCCTCATCGTTATTTCCTACATCTCGAGATGTAGGAAATAACGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-462s1c1
Sequence:CCGGGTGTGCAGAAATGGCTGGAATCTCGAGATTCCAGCCATTTCTGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-329s1c1
Sequence:CCGGGCTGTGCCGTACAGCTTTATTCTCGAGAATAAAGCTGTACGGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004474
OR10S1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily S, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-565s1c1
Sequence:CCGGGCCTACTTCTTCTGCGACATACTCGAGTATGTCGCAGAAGAAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-99s1c1
Sequence:CCGGCGCTAAACATTCTAGCCTCTTCTCGAGAAGAGGCTAGAATGTTTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-678s1c1
Sequence:CCGGCCTCATCGTTATTTCCTACATCTCGAGATGTAGGAAATAACGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-462s1c1
Sequence:CCGGGTGTGCAGAAATGGCTGGAATCTCGAGATTCCAGCCATTTCTGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004474.1-329s1c1
Sequence:CCGGGCTGTGCCGTACAGCTTTATTCTCGAGAATAAAGCTGTACGGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)